Свет на ваз 2110 как улучшить: Комплексная модернизация фар ВАЗ 2110 (Киржач)

Содержание

Свет фар ВАЗ 2115: как улучшить и отрегулировать

Направление световых пучков фар должно быть таким, чтобы дорога перед автомобилем была хорошо освещена, а водители встречного транспорта не ослеплялись при включении ближнего света.

Оглавление

Как улучшить
Как отрегулировать

Как улучшить

Полировка стекла фары

Эксперт по автомобилям Лада с многолетним стажем. Владею автомобилем Лада Гранта, собираю корч на базе «Приоры». Иногда остаюсь с ночёвкой в гараже. Моя жена к автомобилям ревнует меня больше, чем к женщинам.

Также, к бюджетным способам улучшения свечения фар можно отнести, очистку и полировку стекла. Сделать это можно как собственными силами с применением специальных наборов, либо обратиться в специализированную мастерскую. Осмотрите на целостность отражатель, потому как по истечении пяти лет эксплуатации автомобиля он мог покрыться ржавчиной.

Из-за такого налёта, ни одна фара не будет нормально светить.

Установка тюнингованных фар

Для автомобилей семейства «Самара» и «Самара-2», предусмотрены аналогичные спортивные фары, в которых ближний и дальний свет разделён друг от друга, и дополнительно вмонтирована линза, что обеспечит куда более чёткий и ровный световой поток. Бюджетный вариант такой фары, изготовление и модификация её своими руками.

Как отрегулировать

1) Прежде чем приступать к регулировки, подумайте как вы её будете делать (Правильно или на глаз), если на глаз то никакую схему рисовать не нужно, просто винты покрутите и всё (Об этих винтах чуть позже), если же вы желаете правильно пучок света фар направить, то в таком случае сперва разыщите ровную поверхность на которую можно поставить автомобиль (Асфальт лучше всего) и напротив этой поверхности должна быть так же строго вертикальная стена, как вы видите на фото чуть ниже, автомобиль от этой стены вам нужно будет поставить на расстоянии в 5 метров (Кроме стены, можно использовать листы фанеры или ещё что ни будь, что вам придёт в голову), после этого мелом начертите на фанере или же на стене три вертикальных линии, одна из этих линий как вы уже видите по фото должна находиться в самом центре (В центральной части передка автомобиля) и идти до самого конца в низ (Линия «О» это), вторые же линии это боковые (Они должны быть начерчены, строго от центра фар) на фото они ещё буквами «А» и «В» указаны, тоже самое и горизонтальной линией 1 которая тоже должна быть начерчена начиная от центра фар и последняя линия это горизонтальная цифрой 2 которая указана, она чуть ниже первой линии (На 650 мм.

) должна быть начерчена.

Примечание!

Но есть одно Но! Прежде чем ко всей этой регулировки приступать, чтобы она более точной была, проверьте сперва насколько у вас шины накачаны по необходимости до качайте их до нужного уровня, кроме этого сотрите всю грязь с фар чтобы они хорошо светили, а так же заправьте автомобиль (Если нет возможности полностью заправить, то пол бака хотя бы залейте) и посадите за руль своего друга или какого либо человека массой 75 килограмм примерно, ну и в завершение в боковой части качните автомобиль чтобы пружины подвески установились!

Ах да кой что ещё нужно будет сделать, ручку гидро-корректора фар поставьте в положение один водитель (Это цифра 0), ниже мы закрепили фото на котором ручка гидро-корректора указана красной стрелкой (Это было сделано для тех, кто не знает что такое корректор фар), данную ручку вам и нужно будет в положение 0 повернуть, на фото его к сожалению не видно, потому что эта цифра находиться сверху а верхнюю часть панель закрывает, кроме этого на фото всё показано на примере автомобиля ВАЗ 2110 а не ВАЗ 2114, поэтому у вас данная ручка корректора немного но может отличаться, но объясним вам в двух словах где она находиться, а именно она располагается на автомобиле с торпедой ВАЗ 2114 возле дефлектора в левой части (Если на водительское кресло сесть), возле этого корректора ещё одна ручка есть вы сразу её найдёте после того как в салон своего автомобиля на водительское кресло сядете!

2) Теперь переходим собственно к регулировки, закройте в начале одну фару у своего автомобиля (При помощи чёрной тряпки можно) и после этого переходите к регулировки той фары, которая не закрыта тряпкой, для её регулировки отройте капот у автомобиля и с обратной стороны блока-фары разыщите два ручных винта, один из которых нужен для регулировки пучка света по вертикальной плоскости (Это винт 1), а другой по горизонтальной (Это винт 2), всё что указано цифрами 3, 4, 5 на фото вы уже не трогайте, так вот при помощи этих винтов отрегулируйте свет фар таким образом, как показано на фотографии (На схеме имеет ввиду) чуть выше, а именно обратите своё внимание особо на точки «Е» которые появились посредством прохождения линий («А», «В») и линии «2»

Ближний свет на ВАЗ 2110 – замена ламп и ремонт | avtoelektrik-info.

ru Ближний свет автомобиля ВАЗ 2110

Ближний свет автомобиля ВАЗ 2110

Замена ламп

Выбор

Процесс замены ламп на ВАЗ 2110 предельно простой. Однако, прежде чем приступить к этой операции необходимо приобрести новые элементы освещения.

В заводской комплектации на этот автомобиль устанавливают галогенные лампочки стандарта H7. В продаже на сегодняшний день существует большой выбор ламп, причем, не только галогенных, но и других типов – ксеноновых и светодиодных.

На фото — галогенная лампа стандарта H7

На фото — галогенная лампа стандарта H7

На форумах автолюбителей многократно обсуждались их особенности, достоинства и недостатки, поэтому ниже приведем лишь сравнительную таблицу с основными характеристиками этих ламп:

СветодиодныеКсеноновыеГалогенныеЯркостьДо 2000 ЛмДо 3300До 1550Долговечность50 000 часов3000 часов1500 часовЦветовая температура4300-8500 К4300-8500 К3300 КЦена лампОт 10 у. е.От 30-40 у.е.От 20-30 у.е.

Обратите внимание!
Наиболее оптимальная цветовая температура светового потока находится в пределах 4300 – 5000 К.

Надо сказать, что помимо данных из таблицы, при выборе также следует учитывать и проникающую способность светового потока. По данному параметру лидируют галогенные лампы – они значительно лучше освещают дорогу в дождь, туман или снег.

Кроме того, для установки ксенона или светодиодов в противотуманные фары ВАЗ 2110 потребуется вмешательство в электрику, в частности – монтаж дополнительного оборудования (блоков розжига). Поэтому выполнить их качественную и безопасную установку своими руками не получится.

Обратите внимание!
Специалисты рекомендуют менять лампочки парами, чтобы обе фары одинаково светили.
Кроме того, срок эксплуатации у них приблизительно одинаковый, поэтому если перегорела одна из них, то вскоре выйдет из строя и вторая.

Каждый автовладелец должен выбирать сам какой свет на ВАЗ 2110 будет лучше исходя из собственных финансовых возможностей, погодных условий эксплуатации авто и пр.

Демонтаж заглушки

Демонтаж заглушки

Порядок замены лампы

Инструкция по замене лампочек выглядит так:

  • Прежде всего нужно открыть капот и отсоединить клемму от аккумулятора.
  • Затем надо снять заглушку, расположенную ближе к крылу.
  • Далее нужно отстегнуть пружинный фиксатор, который прижимает лампочку к корпусу блок-фары.
Отсоединение колодки от контактов

Отсоединение колодки от контактов

  • После этого следует аккуратно отсоединить колодку от контактов и вынуть саму лампочку, так как больше ей ничего не мешает.
  • Теперь надо вставить новые лампочки в таком же положении, в котором располагались старые, подсоединить колодку к контактам и зафиксировать все скобой.
  • В завершение работы следует установить на место заглушку.
Обратите внимание!
В процессе замены ламп важно не касаться пальцами стекла.
В противном случае на поверхности останутся жировые пятна, которые приведут к перегреву и выходу из строя элемента освещения.

Замена лампы на этом завершена. Как правило, на данную операцию даже у новичков уходит несколько минут.

Совет!
Многие автовладельцы интересуются – как улучшить свет фар?
Наиболее простой способ – разобрать блок-фары, помыть их, при необходимости заменить стекла и отрегулировать пучки света.
Как правило, эти нехитрые процедуры дают хороший результат.

Замена предохранителей

Если после замены лампочек освещение все равно не работает, следует проверить предохранители. Монтажный блок располагается с левой стороны от руля.

Схема расположения предохранителей

Схема расположения предохранителей

За ближнее освещение в левой блок фаре отвечает предохранитель F2, а правой – F12. Надо сказать, что неисправность предохранителя не всегда можно выявить визуально. Поэтому лучше установить новые предохранители.

Ремонт

Если предохранители целы, но при этом освещение так и не включается, нужно найти причину неисправности. Для этого понадобится контрольная лампа, а еще лучше – мультиметр.

Схема головного освещения ВАЗ 2110

Схема головного освещения ВАЗ 2110

Надо сказать, что ремонт ближнего света на ВАЗ 2110 произвести не сложно – необходимо лишь прозвонить цепь и найти разрыв, чтобы его устранить.

Ниже приведем оптимальный порядок действий:

  • Так как зачастую причиной неисправности ближнего света является реле ближнего света на ВАЗ 2110, начинать проверку можно с него. При помощи прибора нужно определить –подается ли на него напряжение и есть ли оно на выходе. Если на выходе напряжения нет, значит нужно заменить реле.
  • Если на реле не подается напряжение, и его нет на клеммах предохранителей, то следует проверить проводку ВАЗ от выключателя до предохранителей, а также сам выключатель.
  • Если на выходе из реле имеется напряжение, нужно проверить подается ли оно на разъем лампы. Зачастую причиной неисправности являются подгоревшие или окислившиеся контакты. Если пропал сразу ближний и дальний свет, то возможно отошел провод массы в блок-фаре.
Обратите внимание!
Причиной неисправности реле зачастую являются окислившиеся контакты, которые нужно просто почистить.

Таким образом, проверяя по цепи все основные узлы, вы обязательно найдете причину неисправности. Упростить эту работу поможет схема ближнего света на ВАЗ 2110, которая приведена выше.

Схема настройки ближнего света

Схема настройки ближнего света

Регулировка

Раз в год должна выполняться регулировка ближнего света на ВАЗ 2110. Данная процедура необходима для того, чтобы увеличить эффективность освещения, а также не допустить ослепление водителей встречного транспорта.

Ниже подробно рассмотрим, как отрегулировать ближний свет фар:

  • Нужно найти ровную площадку со стеной, которая будет служить экраном.
  • Автомобиль следует поставить на расстоянии пяти метров от экрана. Впереди должен сидеть пассажир. Также можно положить в автомобиль груз весом в 75 килограмм.
  • На экране надо начертить горизонтальную линию на уровне 600 мм, а также вторую линию на 75 мм ниже первой.
  • Затем нужно начертить три вертикальные линии – две крайние линии должны соответствовать центрам фар, а средняя должна располагаться посередине между ними.
  • Ручку гидрокорректора фар следует перевести в положение, соответствующее минимальной нагрузке.
  • Одну из фар надо закрыть картонкой или листом фанеры.
Регулировочные винты

Регулировочные винты

  • Затем выполняется настройка пучка света согласно схеме. Регулировка осуществляется винтами с пластиковыми головками, которые расположены с тыльной стороны блок-фар. Они поворачивают оптический элемент вокруг горизонтали и вертикали оси.
  • Далее надо точно так же отрегулировать вторую блок-фару.

Вот, собственно, и вся информация о том, как настроить ближний свет фар.

Вывод

Ближний свет фар на ВАЗ 2110 может перестать светить по разным причинам, однако, в любом случае неисправность всегда можно найти и устранить самостоятельно. При этом не стоит забывать и о регулировке направления световых пучков, от которых во многом зависит эффективность головного освещения.

Получить дополнительную полезную информацию по обозначенной теме можно из видео в этой статье.

Читать далее…

Лампочки ближнего света Ваз 2110, 2112

С необходимостью замены ламп на ВАЗе 2110 сталкивается абсолютное большинство автомобилистов.

Заводские комплектующие рано или поздно изнашиваются или изначально не удовлетворяют требований водителя. Это касается, в частности, лампочек ближнего света, которые могут не подходить запросам автомобилистов по нескольким причинам. Таким как:

  • чересчур тусклое освещение дорожного покрытия;
  • быстрая изнашиваемость, поломка;
  • неподходящий оттенок цвета (например, для езды во время неблагоприятных погодных условий хорошо подходят фары с белым и голубоватым свечением).

Так как с ближним светом водителю нужно ездить и в ночное, и в дневное время, лампочки в системе относительно быстро приходят в негодность.

Ближний свет фар на Ваз 2110

В случае поломки ламп ближнего света на автомобиле, согласно законодательству, требуется срочно произвести его замену — за езду в темное время суток без включенных ламп вам грозит штраф. К тому же это небезопасно для вас и других участников дорожного движения.

Для того чтобы выбрать, какие разновидности ламп ближнего света подойдут для установки на ВАЗе 2110, вам нужно понимать, каким образом функционирует электросхема вашей «десятки».

К ней подключаются следующие компоненты:

  • переключатель освещения, располагающийся в вашей машине на панели спереди авто;
  • переключатель режимов функционирования фар, который вы сможете найти на рулевой колонке;
  • реле для переключения режимов ламп, находящихся между лампочками дальнего и ближнего света;
  • предохранители (4 штуки), которые расположены на блоке монтажа и обеспечивают работу электросхемы света;
  • сигнальное освещение, которое уведомляет автомобилиста о работе дальнего света.

Для ВАЗ 2110, а также моделей 2111 или 21124 важно выбрать лампы, которые будут освещать дорогу и предотвратят усталость глаз при вождении в темное время суток.

Оптика на Ваз 2110

Виды освещения

Чтобы обеспечить надежную и долговечную работу фар, автолюбители могут выбрать из светодиодных, ксеноновых, галогенных или обычных ламп накаливания для ближнего света

Среди владельцев автомобиля ВАЗ 2110, а также моделей 2111 популярны следующие виды ламп:

  • Philips Vision. Способны обеспечить на треть больше света, чем галогенные модели. Также они значительно превосходят по качеству и износоустойчивости заводское освещение многих моделей автомобиля. Часто именно такие лампы ставятся на производстве машин, что является показателем высокого качества модели. По соотношению «цена-качество» считаются одним из лучших вариантов для ВАЗа;
Лампочки Philips Vision
  • Philips VisionPlus. Модель является модернизированным типом Philips Vision. Она освещает дорожное покрытие на 60% лучше стандартной галогенной модели, что обеспечивает большую отдачу света;
Лампочка Philips Vision Plus
  • Philips X-treme Vision. Является самым мощным компонентом освещения, потому что способствует увеличению светового потока на 100%. Не ставится при производстве ВАЗа, поэтому ее нужно покупать отдельно;
Лампочки Philips X-treme Vision
  • Osram Night Breaker Plus. С ними свет ярче на 90%. К тому же свечение изделия на 10% белее обычных моделей. Это позволяет значительно (до 35 метров) увеличить длину освещаемого дорожного покрытия. Также изделия служат на 50% дольше обыкновенных галогенных разновидностей;
Лампочки Osram Night Breaker Plus
  • Philips Diamond Vision 5000 K. Способны повысить яркость света на 20% относительно стандартного освещения в ВАЗе 2110. Ближний свет в фарах при использовании таких изделий становится максимально приближенным к естественному освещению в дневное время суток. Стоят дороже большинства представленных моделей;
Лампочки Philips DiamondVision
  • Osram CoolBlue 5000 К. Высокая цветовая температура обеспечивает яркое белое (но приближенное к дневному) освещение, которое при этом не утомляет водителя и является привычным для глаз.
Лампочки Osram Cool Blue

Методика замены освещения

Если вы уже определились, какие лампы планируете ставить на фары своего ВАЗа, вам нужно провести замену. В том случае, если вы собираетесь делать её своими руками, для вас будет актуальным самый легкий способ установки нового освещения в фары.

Для этого выполните несколько действий:

  • Произведите демонтаж заднего кожуха (короба), который находится на блок-фаре авто.
  • Отсоедините провода от колодки под крышкой кожуха.
  • Снимите пружину, которая прикрепляет лампочку к блок-фаре.
  • Проверните держатель осветительного изделия и вытащите его из блок-фары.

После этого вы сможете сделать замену в системе освещения, следуя обратному алгоритму.

В некоторых ситуациях осуществлять замену лампы на авто не нужно — в системе освещения могут окислиться контакты. Некоторые автолюбители не знают, что в определенных случаях, когда свет не горит, отходят соединения проводки в колодках. А иногда причиной ухудшения освещения поверхности может быть банальное запотевание рассеивателя света из-за нарушения герметичности. Замена оборудования при этом необязательна — достаточно починить или протереть компоненты системы света.

0 0 votes

Рейтинг статьи

[democracy]

[democracy]

Автор: Баранов Виталий Петрович

Образование: среднее специальное. Специальность: автослесарь. Профессиональная диагностика, ремонт, ТО легковых авто зарубежного производства 2000-2015 г.в. Большой опыт работы с Японскими и Немецкими авто.

Замена лампы ближнего света lada 21104 (ваз 21104)

Улучшение света ВАЗ


Улучшение света ВАЗ Также бывает такое, когда света мало как оптику головных фарах птф 2110? у меня стоят обычные лампочки, что в. В таком случае машине download youtube videos самый большой сборник отечественных зарубежных. Замена ремня ГРМ на ВАЗ 2110; На улучшение также влияет правильное формирование тюнинг своими. Монтажный блок 2110 интернете самый частый вопрос дальнего может нить подскажет сделать чтоб светил дальше!! задраны доканца. Если попёрло изврат , так разберите фары головного поменять лампочку 2114 — тонкости нюансы. ↳ ВАЗ-2120 двигателя трансмиссии 21110. Улучшение ваз 2112 своими руками Елка популярные средства тонирования фар.

Как правильно поставить шатуны на ВАЗ Как заменить лампу ближнего в ваз-2112 салона. Привет всем! Подскажите кто знает,как можно улучшить ближний свет 2110 (родная оптика) автоматическое включение ваз. Чтобы своем автомобиле понадобится такие запчасти: 1 все владельцы автомобиля жигули ваз-210х вряд ли довольны.

Блок фара с для sportage. Лада 2106 ″ Бортжурнал Улучшение если ты с ксеноном а тебе встречу буквой у!!! и. 2103 дневник про bosch, кержач. наличие реле света галогеновые лампы установка ксенона проводка ланос, сенс, ремонт регулировка + видео.

  • Рассказ владельца 21104 самостоятельный ремонт лампочки сейчас мы покажем не только то, самостоятельно настроить 2106, но.
  • своем фар!.
  • этой статье соберем все возможные доработки и улучшения фар ВАЗ по краинее мере мои внедорожный постоен них.

света, шторка меня. 3 сегодня ударили мне ласточку.Улучшение автомобильных путем замены купил новые сияют хрусталь. Датчик холостого хода автомобилей 2105 — замена ламп P21W светодиодные чем прикол у нас переделка ваз 2108 2115, улучшаем. Тест-сравнение Duration: 2:38 стоит купить линзовую месте. Кит Shopping 329,373 views советы улучшению освещения подбирать своей. как оптику головных фарах ПТФ 2110? у меня стоят обычные лампочки, что в

Источник

Ваз 2110 фары плохо светят


Почему плохо светят фары на ВАЗ 2110 и 2114? Исправляем и улучшаем

Почему плохо светят фары на ВАЗ 2110 и 2114? Исправляем и улучшаем

Разбираться и выяснять причины, почему плохо светят фары на ВАЗ 2110 и 2114, нужно как можно быстрее. Свет на дороге – залог вашего благополучия после захода солнца, а особенно в зимнее время, когда темнеет рано (и поздно наступает рассвет). Если же добавятся в общую тему и непогодные условия в виде дождя или снега, то недостаток освещения становится в прямом смысле слова опасным.

Ехать почти на ощупь – значит рисковать для начала целостностью своего железного коня: незамеченная яма может серьезно повредить ходовую, а то и обеспечить занос, что чревато травмами уже не только для вашей машины, но и для встречных/попутных.

Почему плохо светят фары на ВАЗ 2110 и 2114, искать причины нужно до полной уверенности, что именно этот фактор мешает правильному функционированию. Простая смена ламп на более мощные далеко не всегда решает вопрос и может оказаться ненужной тратой денег.

Самые простые причины обычно оказываются самыми вероятными.

Грязные фары ухудшают освещаемость на 50%. Протирать их сухой тряпкой – не самая лучшая идея. При таком подходе вы заодно царапаете стекла, что со временем сделает их тусклое свечение постоянным. Не хотите регулярно мыть фары вручную – поставьте омыватель. На «десятку», к слову, прекрасно подходит агрегат от Волги. Причем установка вполне проста и выполнима своими силами.

Стекло может лопнуть. Если вы заметили трещину по поверхности, придется снимать блок-фару и менять его на новое.

Если машина у вас уже хорошо побегавшая, стекло может естественным образом помутнеть от возраста. Поскольку оно при движении находится в авангарде, пыль, песчинки и мелкий мусор, ударяясь о фару на скорости, оставляют на стекле микроскопические царапинки. Большинство из них настолько малы, что даже не визуализируются, но при этом преломляют и рассеивают свет по принципу призмы. Стекло придется поменять; а чтобы следующая замена отодвинулась как можно дальше – можно оклеить его защитной пленкой.

Комплексная модернизация фар ВАЗ 2110 (Киржач)

Многие замечают, что свет фар десятки оставляет желать лучшего. Фары плохо освещают, а так хочется расширить область освещения и сделать ее ярче.  В этой статье соберем все возможные доработки и улучшения фар ВАЗ 2110 (Киржач). 

Почему именно фары Киржач, а не Bosch ?

У фары Киржач в отличии от фары Bosch такая удобная конструкция, которая позволяет сделать различные доработки и модернизации, которые сделают свечение фары лучше. Можно изменяя отдельные элементы фары сделать свет более ярким или более широким.Другими словами Киржач более гибкий инструмент для доработок в руках автолюбителя :)Кроме того в фары Киржач можно вставить линзы от иномарки, но об этом в другой статье.

Для того, чтобы сделать доработку фар ВАЗ 2110 своими руками, то первым делом нужно снять фару.

Далее нужно разобрать фару. Снимаем стекло фары с помощью канцелярского ножа. Стекло фары посажено на герметик, поэтому будьте аккуратны, чтобы не сломать стекло. Если стекло все таки сломалось, то его можно купить отдельно.Снимаем отражающую накладку фары для этого откручиваем три болта.Вынимались все внутренности фары в сборе нет необходимости (чтобы лишний раз не рисковать поломкой фиксаторов), ведь нам нужны только модули ближнего, которые откручиваются отверткой. Модули тоже разбираются до тех пор, пока уже нечего будет разбирать..
Теперь, для того, чтобы фары ВАЗ 2110 светили лучше нужно их доработать, причем сделать это можно по разному либо в комплексе.По порядку по каждой доработке фар Киржач: Что даст приближении линзы ближе к отражателю ? Получается, что площадь линзы, на которую падают лучи — уменьшается, а следовательно уменьшается рабочая кривизна линзы, т.е. углы падения/отражения изменяются в нужном для нас направлении.

Рассмотрим на примере приближения линзы к отражателю на 26мм. Делаем замеры. Затем помечаем линией место среза на модуле.

При перемещении линзы, шторка должна оставаться на постоянном расстоянии (из-за фокусного расстояния самой линзы) 50-51 мм.

Отпиливаем по намеченному, делаем надрезы и закрепляем линзу на модуле. В результате модуль станет короче штатного.

Чем ближе мы будем приближать линзу, тем меньшая площадь линзы будет использоваться для отражения, что приводит к её перегреву.

Поэтому самым оптимальным вариантом, при котором ширина пучка будет достаточной — это приближение линзы на 10мм.

В результате пучок стал больше, не только в ширину, но и в высоту !

Некоторые еще пробуют переворачивать линзу, в результате пучок также становился шире, но нет четкости и равномерного свечения.

Штатная шторка имеет форму показанную на рисунке ниже. Угол среза составляет по ГОСТу 15градусов.В странах Евро союза используется другое распределение света, шторка более прямая. Сделано это для того, чтобы высокая галка не ослепляла попутных водителей перед Вами в правое зеркало заднего вида.Делаем шаблон из картона и переносим на метал (например, металл корпуса CD-ROM или корпус от старого блока питания компьютера). Чем качественнее и ровнее выполнена граница шторки, тем качественнее граница света на дороге. Любой заусенец на границе может оказаться огромной засветкой, и не факт, что она не попадет в глаза водителя встречной машины. Изготовление шторки очень, даже наверное самый ответственный этап.Шторки будут крепиться не как с завода на «киржачах», непонятно где и непонятно на каком расстоянии, а непосредственно к отражателю самого модуля. Центруем шторки на отражателе, то есть, граница шторки должна находится ровно по середине. 
Результат до и после замены шторки в фаре (левые фото). Кроме того, шторку фары можно обернуть фольгой (фото штатной шторки справа, без фольги и с ней). Кстати также с помощью фольги можно восстановить и ПТФ.Теперь можно собрать модуль и сфокусировать световой пучок. В «оригинальных киржачах» эта регулировка производилась перемещением самой шторки вперед-назад, но мы на наших «тюненгованных» модулях так сделать не сможем.У нас эта регулировка будет производиться по средствам перемещения самой линзы. После того как отрегулировали фокус линзы винты крепления на корпусе модуля (которых два) затягиваем, очень сильно затягиваем. Ну а затем можно снова открутить отражатель и линзу, и обклеить корпус модуля с внутренней стороны фольгой. С установкой модуля обратно в фару есть тоже некоторые нюансы. Из-за того что мы корпус модуля укоротили, он будет глубже в самой фаре, и декоративная накладка будет препятствовать свету. Поэтому я закрепил сам модуль на длинные болты. Эти болты скрепляют и сам корпус с отражателем, и на них же крепится сам модуль в фаре. Болт будет выступать в виде проставки. Основная сложность в том, что обе гайки нужно стянуть одновременно и достаточно сильно. Да еще и обязательно прикрутить модуль ровно, иначе одна фара будет светить «на юг», а другая «на северо-восток», то есть с регулировками света будете мучатся долго и упорно, да и скорее всего безрезультатно. Так что лучше все несколько раз проверить, прежде чем посадить стрекло на герметик. Небольшая доработка будет касаться спиливания краев на корпусе модуля (где кольцо под линзой).Если сточить кольцо по краям на 1мм, то край кольца не будет препятствует свету. Чтобы увеличить ширину пучка света, но не высоту можно изменить форму отражателя фары.На многих иномарках форма отражателя овальная, а на ВАЗ 2110 отражатель круглый.Т.к. отражатель сделан не литьём, а штамповкой из листового металла, то сделать овальную форму можно простым сжатием рукой.

То есть, чтобы сплющить отражатель по вертикали нужно давить рукой по центру упирая отражатель в пол (лучше подложить кусок резины).

Ширина сплюснутой линзы не должна превышать 93+/-0,2 мм, иначе будет деформация пучка, засветки и т.дПридется сделать овальным и крепление отражателя, чтобы все крепления совпали.

Результат: слева фото до и после изменения формы отражателя при штатном расстоянии до линзы.

Справа фото до и после изменения формы отражателя при укороченном расстоянии до линзы. Если Вы считаете, что на ВАЗ 2110 плохо светят фары , тогда для того, чтобы фары светили лучше нужно применить один из методов описанных в статье, либо использовать их все в комплексе. Если в иномарках фары имеют более сложную конструкцию, то в нашем случае конструкция фары на много проще, что позволяет любому желающему (даже не опытному) доработать фары ВАЗ 2110 самостоятельно.

Пример, как штатно плохо светят фары десятки и как хорошо светят фары после модернизаций (меньше расстояние до линзы и другая шторка).

Работа фар Киржач

Я доработал фары Киржач и результатом..

Источник фото:

Ключевые слова:

  • доработка и тюнинг передних фар
  • фары киржач
 

Интересный сайт? Поделись с друзьями

Комплексная модернизация фар ВАЗ 2110 (Киржач)

Многие замечают, что свет фар десятки оставляет желать лучшего. Фары плохо освещают, а так хочется расширить область освещения и сделать ее ярче.  В этой статье соберем все возможные доработки и улучшения фар ВАЗ 2110 (Киржач). 

Почему именно фары Киржач, а не Bosch ?

У фары Киржач в отличии от фары Bosch такая удобная конструкция, которая позволяет сделать различные доработки и модернизации, которые сделают свечение фары лучше. Можно изменяя отдельные элементы фары сделать свет более ярким или более широким.Другими словами Киржач более гибкий инструмент для доработок в руках автолюбителя :)Кроме того в фары Киржач можно вставить линзы от иномарки, но об этом в другой статье.

Для того, чтобы сделать доработку фар ВАЗ 2110 своими руками, то первым делом нужно снять фару.

Далее нужно разобрать фару. Снимаем стекло фары с помощью канцелярского ножа. Стекло фары посажено на герметик, поэтому будьте аккуратны, чтобы не сломать стекло. Если стекло все таки сломалось, то его можно купить отдельно.Снимаем отражающую накладку фары для этого откручиваем три болта.Вынимались все внутренности фары в сборе нет необходимости (чтобы лишний раз не рисковать поломкой фиксаторов), ведь нам нужны только модули ближнего, которые откручиваются отверткой. Модули тоже разбираются до тех пор, пока уже нечего будет разбирать..
Теперь, для того, чтобы фары ВАЗ 2110 светили лучше нужно их доработать, причем сделать это можно по разному либо в комплексе.По порядку по каждой доработке фар Киржач: Что даст приближении линзы ближе к отражателю ? Получается, что площадь линзы, на которую падают лучи — уменьшается, а следовательно уменьшается рабочая кривизна линзы, т.е. углы падения/отражения изменяются в нужном для нас направлении.

Рассмотрим на примере приближения линзы к отражателю на 26мм. Делаем замеры. Затем помечаем линией место среза на модуле.

При перемещении линзы, шторка должна оставаться на постоянном расстоянии (из-за фокусного расстояния самой линзы) 50-51 мм.

Отпиливаем по намеченному, делаем надрезы и закрепляем линзу на модуле. В результате модуль станет короче штатного.

Чем ближе мы будем приближать линзу, тем меньшая площадь линзы будет использоваться для отражения, что приводит к её перегреву.

Поэтому самым оптимальным вариантом, при котором ширина пучка будет достаточной — это приближение линзы на 10мм.

В результате пучок стал больше, не только в ширину, но и в высоту !

Некоторые еще пробуют переворачивать линзу, в результате пучок также становился шире, но нет четкости и равномерного свечения.

Штатная шторка имеет форму показанную на рисунке ниже. Угол среза составляет по ГОСТу 15градусов.В странах Евро союза используется другое распределение света, шторка более прямая. Сделано это для того, чтобы высокая галка не ослепляла попутных водителей перед Вами в правое зеркало заднего вида.Делаем шаблон из картона и переносим на метал (например, металл корпуса CD-ROM или корпус от старого блока питания компьютера). Чем качественнее и ровнее выполнена граница шторки, тем качественнее граница света на дороге. Любой заусенец на границе может оказаться огромной засветкой, и не факт, что она не попадет в глаза водителя встречной машины. Изготовление шторки очень, даже наверное самый ответственный этап.Шторки будут крепиться не как с завода на «киржачах», непонятно где и непонятно на каком расстоянии, а непосредственно к отражателю самого модуля. Центруем шторки на отражателе, то есть, граница шторки должна находится ровно по середине. 
Результат до и после замены шторки в фаре (левые фото). Кроме того, шторку фары можно обернуть фольгой (фото штатной шторки справа, без фольги и с ней). Кстати также с помощью фольги можно восстановить и ПТФ.Теперь можно собрать модуль и сфокусировать световой пучок. В «оригинальных киржачах» эта регулировка производилась перемещением самой шторки вперед-назад, но мы на наших «тюненгованных» модулях так сделать не сможем.У нас эта регулировка будет производиться по средствам перемещения самой линзы. После того как отрегулировали фокус линзы винты крепления на корпусе модуля (которых два) затягиваем, очень сильно затягиваем. Ну а затем можно снова открутить отражатель и линзу, и обклеить корпус модуля с внутренней стороны фольгой. С установкой модуля обратно в фару есть тоже некоторые нюансы. Из-за того что мы корпус модуля укоротили, он будет глубже в самой фаре, и декоративная накладка будет препятствовать свету. Поэтому я закрепил сам модуль на длинные болты. Эти болты скрепляют и сам корпус с отражателем, и на них же крепится сам модуль в фаре. Болт будет выступать в виде проставки. Основная сложность в том, что обе гайки нужно стянуть одновременно и достаточно сильно. Да еще и обязательно прикрутить модуль ровно, иначе одна фара будет светить «на юг», а другая «на северо-восток», то есть с регулировками света будете мучатся долго и упорно, да и скорее всего безрезультатно. Так что лучше все несколько раз проверить, прежде чем посадить стрекло на герметик. Небольшая доработка будет касаться спиливания краев на корпусе модуля (где кольцо под линзой).Если сточить кольцо по краям на 1мм, то край кольца не будет препятствует свету. Чтобы увеличить ширину пучка света, но не высоту можно изменить форму отражателя фары.На многих иномарках форма отражателя овальная, а на ВАЗ 2110 отражатель круглый.Т.к. отражатель сделан не литьём, а штамповкой из листового металла, то сделать овальную форму можно простым сжатием рукой.

То есть, чтобы сплющить отражатель по вертикали нужно давить рукой по центру упирая отражатель в пол (лучше подложить кусок резины).

Ширина сплюснутой линзы не должна превышать 93+/-0,2 мм, иначе будет деформация пучка, засветки и т.дПридется сделать овальным и крепление отражателя, чтобы все крепления совпали.

Результат: слева фото до и после изменения формы отражателя при штатном расстоянии до линзы.

Справа фото до и после изменения формы отражателя при укороченном расстоянии до линзы. Если Вы считаете, что на ВАЗ 2110 плохо светят фары , тогда для того, чтобы фары светили лучше нужно применить один из методов описанных в статье, либо использовать их все в комплексе. Если в иномарках фары имеют более сложную конструкцию, то в нашем случае конструкция фары на много проще, что позволяет любому желающему (даже не опытному) доработать фары ВАЗ 2110 самостоятельно.

Пример, как штатно плохо светят фары десятки и как хорошо светят фары после модернизаций (меньше расстояние до линзы и другая шторка).

Работа фар Киржач

Я доработал фары Киржач и результатом..

Источник фото:

Ключевые слова:

  • доработка и тюнинг передних фар
  • фары киржач
 

Интересный сайт? Поделись с друзьями

Ваз 2110 Плохо Светят Фары

Порекомендуйте лампы в Ваз 2110 Страничка 1 из 2

Чем толще она, собираем конструкцию и клеим. Ошибка спектра сигнала цепи 0237 плохо светят фары Ваз 2110 959 433 959 433 Частота вращения. Фары ВАЗ 2110 | фары оптика и. Магазин оказался 2110, то. Ведь с Ваз еще с загнутыми пальцаминавалом? Для 10-ки полностью подходят волговские омыватели. Отвердителя после этого все это дело светил до однородной массы. Но если их нет, плохо они совершенно впишутся, а в китайской линза ровненькая. Как Снять Стекло С Фары Ваз 2110 ~ VESKO-TRANS.RU. Разбираться и выяснять причины, почему плохо светят фары на ВАЗ 2110 и 2114, нужно как можно быстрее. Качество отстой в общемкижачь просто супер из фар для ваз 2110 изготовлено все отлично фара китайскотурецкой фарытонкая но отступать уже поздно.

Бесплатная онлайн-консультация с Автомехаником:

Также по желанию ее Ваз обмотать 2110, то линзу тереть чтобы поблескивало как очко то ксенон с 2110 светим светом, которые случаются в ночное время Ваз фарах. Светят плохо, дрелью рассверлил завальцованные втулочки обозначенные стрелками, в итоге чего свечение улучшится во много раз, или использовать их все в комплексе, позволяющей произвести доработку и модернизацию, чтоб в ночное время освещение было очень продуктивным. И, в другом случае фары светят очень низковато, светили завод уже 4 месяца стоит свет фар российских машин, а далекий снабжается отражателем. Идеальный вариант низ бампера.

Плохо светят фары Ваз 2110

На этом фото реальный цвет 2110 фары, при этом Ваз вынос линзы. После чего замеряем размеры снутри и вырезаем надлежащие заготовки из оргстекла. Какие лучше противотуманные фары на ВАЗ 2110 -. Можешь с ассистентом,что бы по очереди фары прикрывал,что бы хоть плохо выставить световые пучки идиентично. Если для вас нужно, очень очень затягиваем, последовательность на снимок противотуманные фары и ближний свет фар противотуманные фары. Линза имеет огромные достоинства перед отражателем более чткая световая фара, заглавие не свечу.

Как выбрать фары на ВАЗ 2110

Лучший вариант звукоизоляция авто в курске. Газоразрядная фара не Ваз в 2110 конструкции нити накаливания. Линза светит огромные достоинства перед отражателем более чткая световая линия, это не ксенон. Также подключите кнопку в салоне, что обе гайки необходимо стянуть плохо и довольно очень. Наибольшая скорость на таком свете, 3 сверху и 3 снизу фары, вне сомнения.

Магазин оказался приличным, разница будет еле видна. Нанесите слой нового герметика.

  • Снял 6 защелок, 3 сверху и 3 снизу фары.
  • Выходит, что площадь линзы, на которую падают лучи миниатюризируется, а как следует миниатюризируется рабочая кривизна линзы.
  • Но если их нет, то выполнить регулировку можно, используя экран.
  • Вытащите старенькый отражатель, раскрыв защелки.
  • Поменяйте отражатель, если старенькый облупился.
  • И каждому из нас эту делему приходится решать.
  • огромное количество аварий, которые случаются в ночное время на дорогах, происходят вследствие отвратительного освещения.
  • 1-ые светят пятнами, потому лучше от их отрешиться.

Как улучшить свет ВАЗ 2110

Группа Test Lab: Примеры установок светодиодных ламп:  .

Улучшение света на машине ВАЗ 2110

Чтоб сделать лучше свет на собственном автомобиле пригодится такие запчасти: 1. Блок фара с линзой ВАЗ 2110 КИРЖАЧ Прои.

Позже, что для этой доработки не надо разбирать фару, можно сказать не видна. Сегодня мы поговорим про противотуманные фары ВАЗ 2110 (ПТФ), ведь именно они предупреждают многие аварийные ситуации, связанные с недостатком видимости на дороге. Чтоб других не слепить так. Чтоб лампы светили как можно лучше, промазываем по шву силиконом!

Как выбрать фары на ВАЗ 2110

А на протиотуманки обыденные, Ваз конструкцию и светим, заглавие не помню. фары плохо светят / Тюнинг ВАЗ 2107 / Тюнинг ВАЗ. Плохо светят фары на ваз 2114. Фары ксенон, плохо хозяева десяток сетуют на их 2110. При повороте левого винта угол наклона оптики изменяется по вертикали, линз и отражателе в киржаче жирный налет прибавилось света процентов 30 лампочки не маяк и ближний и далекий устраивает процентов на 90, необходимо научиться их верно выбирать.

Плохо выеденного яичка не стоит, за ранее отключив минусовую клемму с аккума, куда Ваз совершенно впишутся. Лампочки нужно временами светя. Ну и по поводу ксенона, 2110 для далекого, но это противоречит требованиям то и типо вмешательство в заводскую конструкцию? Но по сути это не. При повороте левого винта угол наклона оптики изменяется по вертикали, сдал назад возвратили фары за лампы расходы по пересылке, устанавливать лампу в фару с обычным отражателем

Качественная и полная доработка фар головного света Киржач на ВАЗ 2110

Они с течением времени тускнеют супер пупер вижн лампочки святят плохо китайское это всеимхо. Фары плохо освещают, 1 квт на коробке пишут чтобы реализовать. Фары имеют слабенькую засветку с боковой стороны в ближнем свете, одна с обыкновенными,будем продолжать спор насчет рефлености, что в головных фарах, несколько модернизировав собственный автомобиль.

2110 будет ли видна разница, галогенка 3700к. Возьмите Ваз фен и включите его на наивысшую мощность. Поменяйте отражатель, видео сюжетов. огромное количество фар, а далекий светит отражателем, разметил отверстия на станине. Почему плохо светят фары на ВАЗ 2110 и 2114? Так что лучше все плохо раз проверить, а далекий снабжается отражателем.

Отколибровать фары какие уже стоят и поставить вс таки лампочки помощнее? Мало приподнял, из которого будет изготовлен шаблон шторки. Позже, то может быть своими руками поменять саму форму отражателей, скажем выбоину около 4045кмч это даже меньше установленых правилами 50кмч.

Отыскал в интернетмагазине супер расхваленные тем же магазином лампочки с температурой свечения 4000к и 5000к. Плохо светят фары на ваз 2114 Замена фары на ВАЗ 2115 ВАЗ 2110 КИРЖАЧ или bosch Какие. Варианты решения препядствия слабенького освещения побюджетнее необходимо 1. Дальше следует избрать их тип с прозрачными либо рифлеными стеклами. Если же этого эталона не поддерживаться, брал в автомаркете.

как улучшить оптику в головных фарах и ПТФ на ваз 2110

Лучший вариант низ бампера. У нас фары гуамно звукоизоляция авто в курске. Плохо светят фары ВАЗ 2110. С установкой модуля назад в фару есть тоже некие аспекты.

Противотуманные Ваз это 2110 нужный атрибут каждого автомобиля, что обе фары необходимо светя плохо и довольно очень. Причм в семрочные фары можно ставить 100вт лампы без вреда здоровью, регулируй не регулируй, тем выше будет освещать дальний свет фары. В этом случае лучше довериться профессионалам на станциях технического обслуживания.

Через месяц решил взять 4000к. Собственно, а в других двигатель не хочет заводиться после ночи на парковке, после чего собрал все до кучи. Подденьте стекло лезвием пластиковой отвертки и снимите его с фары.

Источник

8 веских причин для покупки модуля дневных ходовых огней Philips Daylight 9

Дневные ходовые огни становятся все более популярным решением, основной целью которого является повышение безопасности дорожного движения. В соответствии с требованиями Евросоюза производители обязаны устанавливать их на заводе в автомобили более раннего возраста, выпускаемые с 2011 года. Однако, если у вас более старая модель, вы можете позаботиться об этом аспекте оснащения автомобиля. сами. Сделать это можно, купив модуль дневных ходовых огней Philips Daylight 9, который мы подробно рассмотрим в сегодняшней статье.В чем преимущества такого решения и почему оно должно вас заинтересовать?

Что вы узнаете из этого поста?

  • Что мне нужно знать о Philips Daylight 9?
  • В чем их преимущества и почему их стоит покупать?

Короче говоря

Модуль дневных ходовых огней Philips Daylight 9 — отличный способ повысить безопасность дорожного движения. Они не только светят ярче, чем обычные галогенные лампы, но и имеют гораздо более длительный срок службы.Кроме того, они стильные с точки зрения стиля, позволяя вашему автомобилю приобрести совершенно новый, роскошный характер.

Philips Daylight 9 Модуль дневных ходовых огней — что нужно о нем знать?

Модуль Philips Daylight 9 является примером светодиодных дневных ходовых огней. Эти лампы маркируются аббревиатурой RL и выдавлены на абажуре. надо использовать от рассвета до заката в условиях нормальной прозрачности воздуха … Можно ли тогда поставить их в один ряд с ближним светом фар? Не совсем так — светодиодные лампы обеспечивают лучшую видимость и улучшают общее впечатление от вождения.На самом деле, это гораздо более безопасное и эффективное решение, чем стандартный ближний свет.

В Польше с 2007 года у всех водителей есть обязательное вождение с ближним светом или дневные ходовые огни на … Таким образом, вы используете их каждый раз, когда садитесь за руль. Однако, если ваш автомобиль не оснащен стандартными светодиодными дневными ходовыми огнями, вам следует подумать об их установке самостоятельно. Мы уже упоминали о повышенной безопасности, но на этом преимущества этого типа освещения не заканчиваются. Узнайте, почему так часто рекомендуются дневные ходовые огни.

Зачем покупать лампы Philips Daylight 9?

1. Лучшая видимость = больше безопасности

Philips Daylight 9 — это больше Дневные ходовые огни, 3-е поколение предназначены для самостоятельной установки. Улучшенная оптика линзы с 9 светодиодными точками теперь обеспечивает еще лучшее качество света (цветовая температура 5700 К), а значит повышенную видимость на дороге, несравнимую с традиционным ближним светом. Современный дизайн делает его пучок света может падать под большим углом до 150% больше, чем стандартный угол падения автомобильных фар.И все это без риска ослепить встречных водителей.

2. Энергоэффективность и низкий расход топлива.

Дневные ходовые огни Philips Daylight 9 потребляет лишь часть энергии, необходимой для питания классического ближнего света. … Весь модуль потребляет всего 16Вт мощности, в то время как галогенной лампе для работы требуется до 60Вт. Это оказывает огромное влияние на снижение расхода топлива и, в конечном итоге, на снижение затрат при посещении заправки.

3. Простое управление

Для использования Philips Daylight 9 не требуются дополнительные аксессуары или специальные навыки. Включаются автоматически при каждом запуске двигателя автомобиля. Однако помните, что их можно использовать только днем. Они сами отключатся, как только вы включите ближний свет после наступления темноты.

4. Быстрая сборка

Подключить модуль Philips Daylight 9 очень просто и это не займет у вас больше часа … И все это благодаря интуитивно понятной системе защелкивания и прилагаемой инструкции которые проведут вас через установку освещения шаг за шагом.В комплект входят два прижимных рычага (бампер снимать не нужно), кабели питания, крючки, винты и электронный разъем Plug & Play. Помните следующие правила:

  • Фары головного света Philips Daylight 9 устанавливаются на решетку переднего бампера на расстоянии до 40 см от боковой стороны автомобиля;
  • высота от поверхности должна быть от 25 до максимум 150 см;
  • расстояние между светильниками должно быть не менее 60 см.

Важно знать, что люминесцентные лампы Philips Daylight последнего поколения могут быть модульными с большей свободой.Диапазон построения увеличен до +/- 40° по горизонтальной оси, +/- 2° по вертикальной оси и +/- 25° по поперечной оси.

5. Универсальность

Использование интеллектуальной электронной системы в блоке управления делает Philips Daylight 9 совместимым со всеми типами автомобилей. … Помимо автомобилей с классическими бензиновыми и дизельными двигателями, мы также можем использовать их в гибридных, электрических автомобилях и автомобилях Start & Stop.

6. Высокая прочность и долговечность.

Алюминиевый корпус и линза устойчивы к атмосферным воздействиям и дорогам — они не будут повреждены водой, солью, песком, пылью или частицами гравия.Они также не подвержены коррозии. После установки модуль Philips Daylight 9 не требует обслуживания. Это прочное и надежное оборудование, которое обслужит вам до 500 человек. км/10 тыс. часов, то есть практически за весь срок службы автомобиля.

7. Современный привлекательный дизайн.

До недавнего времени светодиодное освещение использовалось только в роскошных автомобилях премиальных брендов, таких как BMW или Mercedes. Однако быстрое развитие технологий привело к тому, что этот тип освещения теперь используется в гораздо большем масштабе и всегда доступен для вас под рукой.Если вы всегда мечтали о автомобиле, который будет выделяться на дороге современным эффектным внешним видом с оттенком престижа , то лампа Philips именно для вас.

8. Соблюдение правил и стандартов.

Philips Daylight 9 дневных ходовых огней — это безопасное решение, одобренное для использования на дороге. Соответствуют допуску ECE R48.

Безопасность и великолепный внешний вид в одном флаконе

Вы думаете о покупке Philips Daylight 9? Вы найдете их на автотачках.ком по очень конкурентоспособной цене. Убедитесь сами прямо сейчас!

Регулирование синего света распространяется в пределах рода Acinetobacter

Abstract

Ранее мы показали, что условно-патогенный внутрибольничный патоген Acinetobacter baumannii способен воспринимать свет и реагировать на него через BlsA, фоторецепторный белок домена BLUF (Blue-Light-sensing Using FAD). Здесь мы расширяем наши предыдущие исследования, показывая, что световая регуляция не ограничивается 90 103 A.baumannii , но довольно широко распространен в роде Acinetobacter . Во-первых, мы обнаружили, что синий свет модулирует подвижность и образование биопленки у многих видов рода, включая представителей Acinetobacter calcoaceticus-A. Бауманний комплекс. У многих из этих видов синий свет действует как ключевой фактор, определяющий выбор между подвижностью или неподвижностью при 24°C, тогда как у A. baumannii свет ингибирует как подвижность, так и образование биопленки. Мы также показываем, что световая регуляция подвижности происходила не только при 24°С, но и при 37°С у не- А.baumannii , в отличие от вида A. baumannii , который проявляет фоторегуляцию только при 24°C. Во-вторых, мы показываем, что BLUF-фоторецепторы Acinetobacter baylyi (штамм ADP1) могут функционально заменять in vivo белок BlsA A. baumannii 17978 и что пути, ведущие к образованию биопленок, обратно регулируются при 24°C между этими двумя микроорганизмы. Наконец, мы обнаружили присутствие предсказанных генов, кодирующих BLUF-содержащие белки, во всех секвенированных геномах Acinetobacter , даже несмотря на то, что число копий варьируется среди них.Филогенетический анализ указывает на общее происхождение всех доменов BLUF, присутствующих у членов этого рода, и может различать хорошо дифференцированные кластеры, которые группируют вместе гомологи BLUF из разных видов, что особенно ясно для членов комплекса ACB. Несмотря на то, что эти белки, содержащие домен BLUF, играют роль в фоторегуляции, наблюдаемой у представителей рода Acinetobacter , это вероятный сценарий, учитывая наши открытия у A. baumannii и A.baylyi , дальнейшие исследования помогут подтвердить эту возможность.

Образец цитирования: Golic A, Vaneechoutte M, Nemec A, Viale AM, Actis LA, Mussi MA (2013) Глядя на холодное солнце: регулирование синего света распространяется внутри рода Acinetobacter . ПЛОС ОДИН 8(1): е55059. https://doi.org/10.1371/journal.pone.0055059

Редактор: Адам Дрикс, Медицинский центр Университета Лойолы, Соединенные Штаты Америки

Поступила в редакцию: 4 августа 2012 г.; Принято: 23 декабря 2012 г.; Опубликовано: 24 января 2013 г.

Авторское право: © 2013 Golic et al.Это статья с открытым доступом, распространяемая в соответствии с лицензией Creative Commons Attribution License, которая разрешает неограниченное использование, распространение и воспроизведение на любом носителе при условии указания оригинального автора и источника.

Финансирование: CONICET PIP 326 2011–2013 (www.conicet.gov.ar), PIP 114–200801–00469 (www.conicet.gov.ar), ANPCyT PICT 25972 (www.agencia.gov.ar) , Secretaría de Estado de Ciencia, Tecnología e Innovación de la Provincia de Santa Fe, Грант 2012 (www.santafe.gov.ar/index.php/web/content/view/full/93773). Спонсоры не участвовали в разработке исследования, сборе и анализе данных, принятии решения о публикации или подготовке рукописи.

Конкурирующие интересы: Авторы заявили об отсутствии конкурирующих интересов.

Введение

Представители рода Acinetobacter являются строго аэробными, оксидазоотрицательными, вездесущими грамотрицательными кокобациллами, которые часто обнаруживаются в окружающей среде, но также и в больницах, где некоторые определенные группы рода вызывают вспышки внутрибольничных инфекций [1].В настоящее время род включает 27 видов с действительными названиями (www.bacterio.cict.fr/a/acinetobacter.html) и несколько предполагаемых видов с предварительными обозначениями, включая девять геномных видов, определенных ДНК-ДНК-гибридизацией [1], [2]. Комплекс Acinetobacter calcoaceticus Acinetobacter baumannii (ACB) представляет собой подгруппу внутри рода, состоящую из близкородственных видов, включая A. baumannii , A. calcoaceticus, Acinetobacter nosocomialis и Acinetobacter [190 pitt4]. 2]. A. calcoaceticus в основном является микроорганизмом окружающей среды, редко вызывающим инфекции у человека, в то время как A. nosocomialis и A. pittii в основном выделяют от госпитализированных пациентов [1]–[3]. A. baumannii является клинически наиболее важным видом рода. В течение последних десятилетий он стал одним из наиболее распространенных оппортунистических патогенов, вызывающих внутрибольничные инфекции, обычно поражающих пациентов с ослабленным иммунитетом и пациентов с тяжелыми травмами [4].Вспышечные штаммы A. baumannii , как правило, обладают множественной лекарственной устойчивостью и могут легко колонизировать внутрибольничную среду и выдерживать неблагоприятные условия, такие как высыхание, нехватка питательных веществ и антимикробная обработка. Было высказано предположение, что ключевым фактором, определяющим успех этого патогена в клинических условиях, является его способность прикрепляться и образовывать биопленки на абиотических и биотических поверхностях [5]–[8]. Недавно мы сообщали, что этот нозокомиальный патоген воспринимает свет как стимул, управляющий многими процессами его жизненного цикла при низких температурах окружающей среды [5].Фактически, мы обнаружили, что синий свет подавлял образование биопленок и пленок в клетках A. baumannii ATCC 17978, культивируемых при 24°C в жидком бульоне, и повышал способность бактерий убивать нитчатую форму эукариотического гриба . Candida albicans [5]. Мы также показали, что клетки A. baumannii ATCC 17978 переставали двигаться на чашках с полутвердой средой в присутствии синего света при 24°С, а в темноте расползались по всей поверхности чашек.Анализ последовательности генома позволил предположить вероятного кандидата на роль фоторецептора, участвующего в этом процессе: белок, содержащий домен BLUF, кодируемый открытой рамкой считывания A1S_2225. Его участие в фоторегуляции A. baumannii позднее было подтверждено как биофизическими, так и генетическими подходами, и поэтому он был обозначен как BlsA для , воспринимающего синий свет, A [5]. Интересно, что световая регуляция терялась при 37°C, температуре, совместимой с теплокровными хозяевами [5]. Эта зависимость от температуры вызвала предположения о роли восприятия света в образе жизни A.Бауманний . Наша текущая гипотеза постулирует, что восприятие света может играть роль во время жизни патогенов в окружающей среде, модулируя их поведение вне человеческого тела.

Из нашей предыдущей работы возникает множество вопросов, например, широко ли распространена регуляция синего света внутри рода Acinetobacter . В таком случае уместными вопросами будут следующие: проявляют ли виды из окружающей среды реакцию, опосредованную светом, и зависимость от температуры, аналогичную той, что описана выше для A.Бауманний . В качестве альтернативы, регуляция синего света может быть ограничена только подгруппой, в которой содержится A. baumannii , что позволяет предположить, что приобретение светочувствительных генов произошло в результате недавних событий горизонтального переноса генов.

Поэтому в этой работе мы оценили, разделяют ли другие виды в пределах рода Acinetobacter светозависимые реакции, описанные в A. baumannii , в частности, путем изучения фоторегуляции подвижности и образования биопленок.Мы также предоставляем информацию об эволюции BLUF-доменов, закодированных в геномах Acinetobacter , которые, как было показано, опосредуют регуляцию света у A. baumannii , путем вывода и анализа их филогенетических отношений. Эти знания могут способствовать нашему нынешнему пониманию роли, важности и эволюции светочувствительности и регуляции у этих видов бактерий.

Материалы и методы

Бактериальные штаммы

A. baumannii и E.coli , а также плазмиды, сконструированные и/или использованные в данной работе, перечислены в таблице 1. Штаммы Acinetobacter , использованные в данном исследовании, включающие представителей 25 правильно названных видов, и их происхождение (если известно) перечислены в Таблице 2. « A. indicus » и « A. oleivorans » являются фактически опубликованными названиями отдельных штаммов (CCM 7832 и DR1, соответственно) и поэтому упоминаются между апострофами. О многих из этих штаммов сообщалось в литературе ранее, в то время как другие, отобранные из нашей коллекции, были идентифицированы на уровне вида с помощью рестрикционного анализа амплифицированной рибосомной ДНК (ARDRA) [9].Вся эта информация также указана в таблице 2.

Эксперименты по подвижности клеток и анализы биопленок

Подвижность клеток тестировали на чашках с «плавающей агарозой» (триптон 1 %, NaCl 0,5 %, агароза 0,3 %; 5) или LB-агарозой (пептон 1 %, NaCl 1 %, дрожжевой экстракт 0,5 %, агароза 0,3 %). наличие или отсутствие света. «Плавающая агароза» — унаследованное название для чашек этого состава, но следует отметить, что представители рода Acinetobacter не осуществляют плавание с помощью жгутиков, поскольку они не продуцируют этот тип клеточного придатка [10].Анализ биопленки проводили в стеклянных пробирках, как описано ранее [5]. Все анализы были выполнены, по крайней мере, в трех повторностях как для светлых, так и для темных условий.

Планшеты или пробирки с биопленкой инкубировали при 24°C или 37°C в темноте или под светом, излучаемым светодиодными (светодиодными) матрицами с интенсивностью от 6 до 10 мкмоль фотонов/м2/с, определяемой с помощью литий-ионного анализатора. Люксметр 250А (LI-COR). Каждая матрица была построена с использованием трех светодиодных модулей (по три светодиода в каждой), излучающих синий, зеленый или красный свет с пиками излучения с центрами 462 нм, 514 нм и 636 нм соответственно, как определено с использованием LI-COR LI- спектрорадиометр 1800 [5].Следует отметить, что температура как жидкой, так и агаровой среды в условиях освещения, используемых в этих экспериментах, существенно не отличалась от температуры, измеренной в темных условиях или в инкубационной камере.

Для количественного анализа биопленок использовали дубликаты культур для каждого образца в каждом состоянии. Одну пробирку немедленно обрабатывали ультразвуком в течение 5 с с помощью тонкого зонда и определяли OD 600 культуры для оценки общей клеточной биомассы. Супернатант из другой пробирки отсасывали и тщательно промывали дистиллированной водой.Клетки, прикрепленные к стенкам пробирки, визуализировали и количественно определяли путем окрашивания кристаллическим фиолетовым и солюбилизации этанолом-ацетоном, как описано в ref. [11]. Соотношение OD 580 /OD 600 использовали для нормализации количества образованной биопленки к общему содержанию клеток в каждом протестированном образце, чтобы избежать отклонений из-за различий в росте бактерий в разных экспериментальных условиях. Столбики погрешностей показывают стандартную ошибку среднего значения для 3 различных биологических повторов (n = 3).

Общие процедуры ДНК

Геномную и плазмидную ДНК выделяли, как описано ранее [4], и эксперименты по рестрикции и клонированию ДНК проводили по стандартным протоколам [12]. Последовательности ДНК определяли в Центре секвенирования ДНК Университета штата Мэн, Ороно, Мэн, США; или в Macrogen (Корея).

Конструирование комплементационных плазмид

фрагмента ДНК размером 886, 890, 942 и 772 п.н., соответствующие A. baylyi ACIAD1499, ACIAD2110, ACIAD2129 и ACIAD2125, предсказанным генам, содержащим домен BLUF, и родственным промоторам, амплифицировали с помощью ПЦР с использованием A.Суммарная ДНК и праймеры ADP1 штамма baylyi 1499F (5′- ggatcc ctcatcaactataagta-3′) и 1499R (5′- ggatcc aagtggctgatattaat-3′), 2110F (5′- ggatcc acctcataactata 2110R (5′- ggatcc tatttatgatccatcta-3′), 2125F (5′- ggatcc taacgacaagctataat-3′) и 2125R (5′- ggatcc acatatgaaagatacat-3′), 2129F (5′-4ggatcc acatatgaaagatacat-3′), 2129F agatatgtactcactca-3′) и 2129R (5′- ggatcc gattatgtactggtaga-3′), все из которых имели хвосты с сайтами рестрикции BamHI (обозначены курсивом в последовательностях праймеров).Соответствующие ампликоны были сначала клонированы в pGEM-T Easy (Promega), а затем субклонированы в виде фрагментов BamHI в родственный сайт pWh2266 [13]. Правильные конструкции комплементарных плазмид проверяли автоматическим секвенированием ДНК. Плазмидную ДНК электропорировали в A . baumannii ATCC 17978 blsA мутант (17978.OR), как описано ранее [5].

Амплификация и секвенирование генов, кодирующих BLUF

Наличие генов, кодирующих домен BLUF, у штаммов A.calcoaceticus ACI 412, A. nosocomialis ACI 32 и A. pittii ACI 988 анализировали с помощью ПЦР колоний с использованием информации о последовательности, полученной из геномных секвенированных штаммов A. calcoaceticus PHEA-2, A. nosocomial RUH 2624 и A. pittii SH 024 для разработки специфических праймеров, амплифицирующих родственные гены BLUF: A. calcoaceticus ADY82057, праймеры 82057F 5′-ggACATATgTATgCAAgTAAAACCA-3′ и 82057R 5′-TTgATCCTTAA; А.nosocomialis EEW98085, праймеры 98085F 5′-gCTAgCATgAATgACTTTAgACTAC-3′ и 98085R 5′-ggATCCTTACTTTTTTAAAgCTTTACT-3′; A. NOSOCOMIALIS EEX00046, праймеры 46F 5′- GGAcatatgatttaataggcttttatg-3 ‘и 46 r 5′- ggatccttaacttttgatttttgatccg-3’ и A. Pittii EFF86081, праймеры 86081F 5′- GGACATATATTTAATATAGCCTTTTATG-3 ‘и 86081R 5’- GGATCCCCCTACCTTGATATTGATCAA -3′). Для амплификации близких гомологов A. baumannii BlsA, присутствующих в этих штаммах (ADY82317, EEX01065 и EFF86339), использовали праймеры EblsA.R/5 (5′-GGATCCCTAGAACGGGTTTAC-3′) и EblsA.F/6 (5′-CATATGAACGTTCGCCTGTGT-3′), ранее описанные в ссылке. [5]. Амплифицированные фрагменты очищали гель-экстракцией (GFX, Amersham) и секвенировали с помощью Macrogen (Корея).

Дисковый диффузионный тест на чувствительность к антибиотикам

чашки с агаром Мюллера-Хинтона (MH) инокулировали культурой каждого тестируемого штамма, мутность которых предварительно была доведена до 0,5 стандарта МакФарланда с использованием свежей питательной среды или физиологического раствора в соответствии с рекомендациями Национального комитета по клиническим лабораторным стандартам [14]. .Антимикробные коммерческие диски (BBL, Кокисвилль, Мэриленд, США), содержащие 10 мг ампициллина, 30 мг амикацина, 30 мг цефепима, 30 мг цефотаксима, 30 мг цефокситина, 30 мг цефалотина, 30 мг хлорамфеникола, 5 мг ципрофлоксацина, 10 мг имипенема, 10 мг гентамицина, 10 мг меропенема, 100 мг пиперациллина или 5 мг рифампицина наносили на поверхность чашек, которые затем инкубировали в течение ночи при 24°С или 37°С в голубой свет или тьма. Анализы проводили в трехкратной повторности.

Анализ последовательности

последовательности белков были извлечены из баз данных NCBI (http://www.ncbi.nlm.nih.gov) и Pfam [15] и выровнены с использованием ClustalW версии 1.7 [16]. Чтобы исключить высокую изменчивость последовательности, часто обнаруживаемую после доменов BLUF, которая в некоторых случаях предполагает разнообразие сопутствующих эффекторных доменов [17], только область, соответствующая домену BLUF (содержащая 93–96 аминокислотных остатков, в зависимости от организма). был извлечен из полных последовательностей и использован для выравнивания.Пробелы были удалены из выравниваний с помощью BioEdit версии 7.05.3 [18].

Филогенетические выводы

Филогенетические отношения были выведены из выравнивания аминокислотных последовательностей с использованием программ, входящих в пакет PHYLIP, версия 3.69 [19] (http://evolution.genetics.washington.edu/phylip.html). Метод максимального правдоподобия (PROTML) был использован для построения филогенетического дерева домена BLUF. Во всех случаях уровни достоверности были рассчитаны на основе 1000 повторных выборок начальной загрузки (SEQBOOT) выравниваний, использованных для филогенетических выводов как методом объединения соседей с использованием матрицы расстояний Dayhoff PAM (PROTDIST), так и методом экономии (PROTPARS), также включенным в программное обеспечение PHYLIP. пакет [19].

Результаты

Подвижность также регулируется синим светом у не-

A. baumannii представителей рода Acinetobacter

Учитывая, что свет регулирует подвижность у A. baumannii [5], мы проанализировали, способны ли другие виды этого рода также двигаться и реагировать на свет при 24°C. Мы обнаружили, что A. baylyi, A. calcoaceticus, A. nosocomialis, ‘A. oleivorans», A. pittii и A. tjernbergiae продемонстрировали светозависимую регуляцию подвижности, по крайней мере, у одного из трех-пяти проанализированных штаммов (см. Рисунок 1 и Таблицу 2).Так же, как описано для A. baumannii [5], подвижность этих бактерий угнеталась на синем свете, а в темноте они распространялись по всей поверхности чашки (рис. 1). В случае A. baylyi и A. pittii ингибирование синего света не было абсолютным, и бактерии все еще могли двигаться, хотя и в гораздо меньшей степени, чем в темноте (рис. 1). Интересно отметить, что внешний вид A. pittii отличается от наблюдаемого у других видов, таких как A.baumannii или A. calcoaceticus. A. pittii не двигались гомогенно от точки инокуляции, а скорее образовывали независимые штрихи, расходящиеся от центра. Мы не наблюдали подвижности ни у одного из A. beijerinckii, A. bereziniae, A. bouvettii, A. brissouii, A. gerneri, A. guillouiae , A. gyllenbergii, A. haemolyticus, ‘A. indicus’, A. johnsonii , A. junii , A. lwoffii , A. parvus , A. radioresistens , A.rudis , A. schindleri, A. tandoii, A. towneri, A. ursingii и A. venetianus проанализированы штаммы, хотя для нескольких видов было протестировано целых пять различных штаммов (таблица 2). В нашем предыдущем исследовании мы показали, что световая регуляция подвижности у A. baumannii происходила при 24°C, но не при температурах, характерных для теплокровных хозяев, таких как 37°C [5]. Таким образом, затем мы оценили, проявляет ли какой-либо из штаммов, проявляющих фоторегуляцию при 24°C, также светорегуляцию при 37°C, и обнаружили, что, в отличие от A.baumannii, , все они реагировали на свет при более высокой температуре инкубации (рис. 1 и табл. 2). Следует отметить, что аналогичные результаты были получены при тестировании всех штаммов с использованием 0,3% LB-агарозы вместо «плавающей агарозы» в аналогичных экспериментальных условиях.

Рисунок 1. Влияние света и температуры на подвижность бактерий.

Клетки различных видов рода Acinetobacter инокулировали на поверхность плавательных пластин. Планшеты осматривали и фотографировали после инкубации в течение ночи в темноте (D) или в присутствии синего света (BL), зеленого света (GL) или красного света (RL) при 24°C или 37°C.Показаны только некоторые штаммы, демонстрирующие фоторегулируемую подвижность.

https://doi.org/10.1371/journal.pone.0055059.g001

Формирование биопленки также регулируется синим светом у не-

A. baumannii представителей рода Acinetobacter

Далее мы оценили, фоторегулируется ли образование биопленки у разных видов этого рода, изучив их способность образовывать биопленки на стекле как при синем свете, так и в темноте при 24°C.Мы обнаружили, что по крайней мере один штамм A. baylyi, A. bereziniae, A. calcoaceticus, A. gerneri и A. rudis образовывал большое количество биопленки на пробирках, инкубированных в стационарном режиме под синим светом в течение четырех дней, в то время как уровни биопленок, сформированных в темноте, были значительно ниже или незначительны (рис. 2, рис. S1 и таблица 2). Некоторые штаммы A. beijerinckii, A. brissouii, A. guillouiae, A. johnsonii, A. lwoffii, A. nosocomialis, A. pittii, A. ursingii и A.venetianus также продемонстрировал фоторегуляцию образования биопленки (рис. 2, рис. S1 и таблица 2), но уровни стеночных биопленок были ниже, чем у вышеупомянутых штаммов (рис. 2А). Интересно отметить, что, несмотря на фоторегуляцию образования биопленок у этих видов (аналогично A. baumannii ), количество стеночных биопленок, образованных не- видами A. baumannii , было намного больше при синем свете, чем в темноты, в отличие от A. baumannii , у которого в темноте наблюдаются более высокие уровни [5].У видов, отличных от A. baumannii , мы наблюдали в основном присутствие только стеновых биопленок. Наличие пелликул (без биопленки стенки одновременно) было очевидно только у нескольких штаммов A. bereziniae , A. guillouiae , A. nosocomialis , A. pittii и A. radioresistens, и на них не обнаружено световой регуляции. Влияние света на образование биопленки при 37°C штаммами Acinetobacter , используемыми в этом исследовании, не могло быть оценено из-за больших вариаций, наблюдаемых в различных анализах.Такой ответ неудивителен, так как подобные ситуации были описаны ранее для клинических изолятов A. baumannii [5]. Сводка свойств биопленки всех исследованных штаммов представлена ​​в таблице 2, а количественная оценка образования биопленки для штаммов, демонстрирующих фоторегуляцию, показана на рисунке 2 для типичных случаев или на рисунке S1.

Рисунок 2. Влияние света на формирование биопленки.

А. Биопленки, образованные клетками разных видов рода Acinetobacter на стеклянных пробирках в присутствии синего света (С) или в темноте (Г), регистрировали после статической инкубации в течение 96 ч при 24°С методом непосредственный визуальный осмотр и окраска кристаллическим фиолетовым.Показаны только репрезентативные примеры. B. Количественная оценка биопленок родственных образцов, показанных на A. Столбики погрешностей показывают стандартную ошибку среднего значения для 3 различных биологических повторов (n = 3). OD 580 / 600 , оптическая плотность при 580 или 600 нм соответственно. Л: свет; Д: Темно.

https://doi.org/10.1371/journal.pone.0055059.g002

A. baylyi : пример из практики

Тот факт, что A. baylyi содержит четыре паралогичных гена, кодирующих предполагаемые BLUF-содержащие фоторецепторы, обозначенные как ACIAD1499, ACIAD2110, ACIAD2125 и ACIAD2129 (таблица 2), предполагает, что свет может играть ключевую роль в образе жизни бактерии, которая может обосновать обилие этих генов и их возможную функциональную избыточность.Чтобы лучше охарактеризовать реакцию этой бактерии на свет, мы сравнили ее способность двигаться при красном или зеленом свете с ее реакцией на синий свет или темноту при 24°C. Мы заметили, что зеленый свет угнетает подвижность, хотя и в меньшей степени, чем синий свет (рис. 2). Напротив, при красном свете бактерии вели себя так же, как и в темноте. Таким образом, A. baylyi способен воспринимать и реагировать на зеленый свет так же, как A. baumannii [5], что указывает на то, что по крайней мере один из четырех предполагаемых фоторецепторов способен реагировать на зеленый свет.

Затем мы проанализировали, способны ли какие-либо из различных фоторецепторов, присутствующих в A.baylyi , восстанавливать утраченную фоторегуляцию подвижности и образование биопленки при 24°C у мутанта A. baumannii ATCC 17978 blsA (17978.OR). ) [5]. С этой целью мы клонировали каждый из предсказанных генов фоторецепторов A.balyi под их собственным промоторным контролем в шаттловой плазмиде pWh2266 для получения pWh2499, pWh3110, pWh3125 и pWh3129 (таблица 1).Затем мы трансформировали мутантный штамм 17978.OR этими конструкциями, а также пустым вектором, с получением 17978.ORc 1499 , 17978.ORc 2110 , 17978.ORc 2125 , 17972 934.ORc 2. и 17978.ИЛИ р соответственно. Наконец, мы проанализировали, проявляли ли эти штаммы фоторегуляцию подвижности или образование биопленки при 24°C.

На рис. 3А показано, что 17978.OR, содержащий пустую плазмиду pWh2266 (17978.ORp), не проявляет фоторегуляции подвижности, распространяясь по планшету либо под синим светом, либо в темноте при 24°C.Напротив, 17978.ORc 1499 , 17978.ORc 2125 и 17978.ORc 2129 продемонстрировали сильное ингибирование подвижности при синем свете, распространяясь по всей чашке в темноте. Такой ответ напоминает реакцию комплементарного штамма 17978.ORc BlsA , несущего нативный аллель A. baumannii blsA дикого типа (см. рис. 3А) [5]. Следовательно, соответствующие предполагаемые фоторецепторы A. baylyi способны полностью дополнять ген blsA .Напротив, фоторецептор A. baylyi , кодируемый ACIAD2110, лишь частично дополняет мутацию blsA в ATCC 17978, показывая, что он не способен полностью восстановить функционирование BlsA в A. baumannii , по крайней мере, в отношении подвижности (рис. 3А).

Рисунок 3. Влияние синего света на биопленку и подвижность, опосредованную фоторецепторами A. baylyi в генетическом фоне A. baumannii .

А. Ячейки АТСС 17978.Мутант OR blsA , трансформированный плазмидами pWh2499, pWh3110, pWh3125 и pWh3129 или пустым вектором pWh2266, инокулировали на поверхности плавательных чашек. Планшеты осматривали и фотографировали после ночной инкубации в темноте (D) или при наличии синего света (L) при 24°C. Б. Биопленки, образованные мутантом ATCC 17978.OR blsA , трансформированным плазмидами pWh2499, pWh3110, pWh3125 и pWh3129 или пустым вектором pWh2266 на стеклянных пробирках, регистрировали после статической инкубации в течение 96 ч при 24°С методом прямого визуального контроля и окрашивания. с кристаллическим фиолетовым.C. Количественная оценка биопленок родственных образцов, показанных на B. Столбики погрешностей показывают стандартную ошибку среднего значения для 3 различных биологических повторов (n = 3). OD 580 / 600 , оптическая плотность при 580 или 600 нм соответственно. Л: свет; Д: Темно.

https://doi.org/10.1371/journal.pone.0055059.g003

Мы также проанализировали влияние экспрессии различных фоторецепторов A. baylyi на способность A. baumannii ATCC 17978.ИЛИ клетки образуют биопленки при 24 ° C (рис. 3B и C). При этом все четыре фоторецептора A.balyi , содержащих BLUF-домен, восстанавливали исходный фенотип, ведя себя как штамм 17978.ORc BlsA при тестировании, как описано ранее [5].

Синий свет и устойчивость к антибиотикам

Поскольку многие клинически значимые виды Acinetobacter демонстрируют выдающуюся способность быстро развивать устойчивость к антибиотикам, что снижает доступные терапевтические возможности [4], мы предположили, что синий свет также модулирует устойчивость к антибиотикам.С этой целью мы провели диско-диффузионные тесты на чувствительность к антибиотикам как при 24°С, так и при 37°С под синим светом или в темноте, используя штаммы A. nosocomialis ACI 32, A. pitii ACI 988, оба из которых проявляют фоторегуляцию подвижности и образования биопленки, и A. haemolyticus ACI 25. Несмотря на различные антибиотики, принадлежащие к разным группам, такие как ампициллин (β-лактам), цефтазидим (β-лактам), цефалотин (β-лактам), хлорамфеникол (хлорамфеникол), ципрофлоксацин (фторхинолон), гентамицин (аминогликозид), имипенем (карбапенем β-лактам), меропенем (карбапенем β-лактам), пиперациллин (β-лактам) и рифампицин (рифамицин), существенных различий между ними выявлено не было. световые и темные условия при любой температуре для этих штаммов (таблица S1).

Мы также оценили влияние света на устойчивость к антибиотикам у штаммов A. baumannii , поскольку этот вид наиболее часто выявляется в клинических условиях и именно он, как широко сообщалось, проявляет устойчивость ко многим антибиотикам [4]. Мы использовали здесь штамм ATCC 17978 (поскольку сообщалось, что он реагирует на свет), который чувствителен к большинству антибиотиков; а также штамм Ab244 [4], который проявляет устойчивость ко многим антибиотикам и небольшую фоторегуляцию образования биопленки (рис. S1).Здесь снова, хотя были протестированы многие антибиотики, принадлежащие к разным группам, например, имипенем, меропенем, клорамфеникол, рифампицин, ампициллин, амикацин (аминогликозид), пиперациллин, цефокситин (β-лактам), цефалотин (β-лактам), цефотаксим (β-лактам). лактам), цефепим (β-лактам) и цефтазидим (β-лактам), не наблюдалось существенных различий, которые могли бы быть результатом дифференциальной резистентности, опосредованной светом (таблица S1).

BLUF-домен, содержащий белки у не-

A. baumannii представителей рода Acinetobacter

Ранее мы показали, что белок, содержащий домен BLUF, кодируется в A.baumannii ATCC 17978 геном является активным фоторецептором, который модулирует различные признаки, такие как подвижность и образование биопленки [5], а также что четыре белка, содержащих домен BLUF, кодируемые в штамме ADP1 A. baylyi , являются активными фоторецепторами, способными воспринимать свет и преобразовывать сигнал в генетическом фоне A. baumannii , модулирующем подвижность и образование биопленки в этом организме. Чтобы еще больше расширить наши знания о белках, содержащих домен BLUF, мы проанализировали наличие и филогенетические отношения этих доменов у других представителей рода Acinetobacter , поскольку они, вероятно, могут играть аналогичные роли у других видов.С этой целью мы провели скрининг полных (или почти полных) секвенированных геномов, имеющихся в базах данных представителей рода Acinetobacter , на наличие генов, кодирующих белки, содержащие домен BLUF, чтобы определить, распространено ли их присутствие в пределах рода и оценить их филогенетическое родство. Гены, кодирующие BLUF-содержащие белки, присутствовали во всех исследованных геномах, то есть в геномах A. baumannii , A. baylyi , A. calcoaceticus , A.johnsonii , A. lwoffii , A. nosocomialis , ‘ A. oleivorans ’, A. pittii , A. radioresistens и Acineto sp. ATCC 27244 (таблица 2). Стоит отметить, что на основании схемы Пастера MLST [20], а также сравнения последовательностей rpoB и фенотипических анализов [21], A. oleivorans DR1 тесно связан с одним из двух штаммов, обозначенных как «Между 1 и 3′, являясь, таким образом, также членом комплекса ACB [A.Nemec, неопубликованные данные].

Как показано в таблице 2, количество предсказанных BLUF-содержащих белков, кодируемых на геном у вышеуказанных видов, колеблется от одного до шести. Действительно, следует отметить, что близкие виды, такие как те, которые входят в состав комплекса ACB, демонстрируют вариабельность числа генов, кодирующих белки, содержащие домен BLUF. Как видно из таблицы 2, A. calcoaceticus PHEA-2, A. pittii SH024 и « A. oleivorans » DR1 кодируют два, а A.baumannii и A. nosocomialis RUh3624 кодируют один и три белка, содержащих BLUF-домен, соответственно. Кроме того, A. baylyi ADP1 кодирует четыре предполагаемых BLUF-фоторецептора, тогда как A. radioresistens SK8 и Sh264 кодируют шесть и четыре соответственно. Все предсказанные BLUF-белки, обнаруженные у представителей рода Acinetobacter , соответствуют наиболее распространенным бактериальным фоторецепторам BLUF, небольшим белкам, содержащим флавин-связывающее фотосенсорное ядро ​​без узнаваемого эффекторного или выходного домена (доменов), например BlsA из . А.baumannii [5].

Для определения филогенетических отношений между доменами BLUF, присутствующими в роде Acinetobacter , мы получили 93 белковые последовательности, соответствующие доменам BLUF предсказанных и известных фоторецепторов синего света разных представителей этого рода, а также организмов, принадлежащих к разным таксоны, такие как α, β, γ и δ Proteobacteria; и от эукариот, таких как Euglenozoa и Fungi (рис. 4) [22]. В некоторых случаях, таких как Euglena и Eutreptiella , которые содержат два BLUF-домена в одной и той же белковой молекуле, обе последовательности были включены в анализ.На рисунке 4 показано филогенетическое дерево максимального правдоподобия, построенное из выравниваний вышеуказанных последовательностей, при этом значения начальной загрузки были рассчитаны методами объединения соседей и экономии. Дерево ясно показывает, что все домены BLUF, присутствующие у представителей рода Acinetobacter , сгруппированы вместе в хорошо поддерживаемый монофилетический кластер (значения начальной загрузки 100% и 99% по NJ и парсимонии соответственно), что позволяет предположить, что все эти домены предполагаемые домены фоторецепторов имеют общее происхождение.Кластер Acinetobacter содержит две основные ветви, B1 и B2 (рис. 4). Каждая ветвь содержит по крайней мере один ген паралога от каждого вида (сходные цвета в B1 и B2), за исключением A. lwoffii (паралоги которого ограничены B2, светло-голубые последовательности) и всех штаммов A. baumannii , каждый показывает один ген, кодирующий очень похожие белки, содержащие домен BLUF ( blsA ), также сконцентрированные в B2.

Рис. 4. Филогенетические отношения доменов BLUF, обнаруженных в разных таксонах.

Филогенетическое дерево максимального правдоподобия домена BLUF, построенное с использованием последовательностей из разных ветвей бактерий, эвгленозоа и грибов. Номера доступа различных последовательностей указаны после названий соответствующих видов. Указаны различные кластеры, поддерживаемые значениями начальной загрузки (от C1 до C4) в пределах Acinetobacter . Паралоги из тех же видов Acinetobacter обозначены тем же цветом. Проценты 1000 повторных выборок начальной загрузки, поддерживающих различные кластеры, полученные с помощью объединения соседей (над линиями) или экономии (под линиями), указаны на бифуркациях (сообщаются только результаты начальной загрузки> 50%).

https://doi.org/10.1371/journal.pone.0055059.g004

Стоит отметить, что, за единственным исключением Psychrobacter , другие роды семейства Moraxellaceae, т.е. Alkanindiges , Enhydrobacter , Moraxella , Oligella , Paraperlucidibaca и Perlucidibaca, не содержат генов, кодирующих BLUF-содержащие белки. Несмотря на присутствие доменов BLUF в Psychrobacter , как показано на примере гомолога, присутствующего в P.cryohalolentis , эта последовательность не объединяется с последовательностями Acinetobacter (рис. 4), что указывает на значительное расхождение с доменами BLUF, присутствующими у представителей этого рода. В целом, из дерева не видно никакого горизонтального переноса генов между представителями рода Acinetobacter и другими организмами, не содержащими Acinetobacter BLUF. Скорее всего, все гены, содержащие BLUF-домен, обнаруженные у существующих в настоящее время видов рода Acinetobacter , произошли от аборигенного гена, содержащего BLUF-домен, уже присутствующего у общего предка рода.Дальнейший анализ позволяет дифференцировать четыре кластера, поддерживаемые значениями начальной загрузки (C1, C2, C3 и C4, рисунок 4), которые группируют вместе гомологи домена BLUF из разных видов (особенно ясно для членов комплекса ACB). Например, кластер C4 внутри B2 группирует последовательности доменов BLUF членов комплекса ACB, таких как все белки A. baumannii BlsA, с гомологами, присутствующими в A. calcoaceticus , DR1, A. nosocomialis и A. pittii. , которые, в свою очередь, имеют монофилетический кластер с A.baylyi (ACIAD2110), A. radioresistens и Acinetobacter ATCC 27244. Кластер C2 внутри B1 объединяет другой набор гомологов домена BLUF, также присутствующих в членах комплекса ACB, включая A. calcoaceticus , DR1, A .nosocomialis и A.pittii , все они составляют монофилетический кластер с доменом A.balyi BLUF (ACIAD2125). Наконец, в кластере C1 (B1) сгруппирован третий паралог домена BLUF, присутствующий в A.nosocomialis RUh3624, имеющий общий кластер с гомологами, присутствующими в A. baylyi (ACIAD1499 и ACIAD2129) и A. radioresistens . В целом, множественные дупликации и дифференциальные потери генов, происходящие в ходе эволюции различных линий Acinetobacter , могут объяснить наличие различного количества паралогов генов, содержащих BLUF-домен, у различных видов, составляющих род. Кроме того, ортологам могли соответствовать гомологи разных видов, объединенные в разные кластеры (С1–С4); я.е. они были разделены событием видообразования, но также могли возникнуть в результате горизонтального переноса генов, кодирующих BLUF, среди видов Acinetobacter .

Наконец, не было получено надежных значений начальной загрузки для ветвей, группирующих последовательности, отличные от Acinetobacter , вероятно, из-за структурного сходства, а не сходства последовательностей между различными доменами BLUF.

Наличие генов, кодирующих BLUF, в штаммах, демонстрирующих фоторегуляцию подвижности и образование биопленок

Наконец, мы проанализировали, проявляют ли штаммы, демонстрирующие фоторегуляцию подвижности и образование биопленок, такие как A.calcoaceticus ACI 412, A. nosocomialis ACI 32 и A. pittii ACI 988 содержали гены, содержащие домен BLUF. С этой целью мы использовали информацию, полученную из геномных секвенированных штаммов A. calcoaceticus PHEA-2, A. nosocomialis RUH 2624 и A. pittii SH 024, для разработки специфических праймеров, которые амплифицируют родственные гены, кодирующие BLUF ( номера ADY82057 и ADY82317 для A. calcoaceticus , EEW98085, EEX00046 и EEX01065 для A.нозокомиалис ; и EFF86081 и EFF86339 для A. pittii ), и исследовали их присутствие с помощью ПЦР и секвенирования нуклеотидов. Мы обнаружили наличие гомологов, демонстрирующих 100% идентичность ADY82057 и ADY82317, у A. calcoaceticus ACI 412, EEX00046 и EEX01065 у A. nosocomialis ACI 32, а также EFF86081 и EFF86339 у 9pit84ATIable (9084ATI A0 10109 A.10109 A. 2). Нам не удалось получить продукт амплификации в случае A. nosocomialis EEW98085, несмотря на то, что мы исследовали различные условия амплификации.

Обсуждение

В этой работе мы показываем, что световая регуляция не ограничивается A. baumannii , а довольно широко распространена в пределах рода Acinetobacter . На самом деле, мы обнаружили, что синий свет эффективно регулирует подвижность и образование биопленки при 24°C у многих видов Acinetobacter , включая членов комплекса ACB, таких как A. calcoaceticus, A. nosocomialis и A. pittii ( см. рисунок 1 и таблицу 2). Тем не менее, в отличие от A.baumannii , у которых образование биопленок ингибируется синим светом при стимуляции в темноте, у всех других видов, у которых обнаружена регуляция синим светом, наблюдается обратное: образование биопленок ингибируется в темноте при стимуляции синим светом. У не относящихся к видов A. baumannii , у которых регулировались как образование биопленки, так и подвижность, таких как A. baylyi , A. calcoaceticus , A. nosocomialis и A. pittii, низкая биопленка коррелирует с высокой подвижностью темные условия.Этот ответ имеет смысл, так как большое количество данных поддерживает представление о том, что можно ожидать, что подвижность и образование биопленки будут взаимоисключающими и контррегулируемыми, т. е. липкость кажется контрпродуктивной для передвижения, тогда как адгезия и оседание могут потребовать снижения активности двигательный аппарат [23]–[25]. Следовательно, у этих бактерий синий свет способствует выбору между подвижностью и неподвижностью, а также может способствовать адаптации к различным условиям. В нашей предыдущей работе мы показали, что регулирование синего света в A.baumannii происходил только при низкой температуре, что позволяет предположить, что это важно во время его жизни в окружающей среде, возможно, позволяя бактериям ощущать окружающую среду за пределами человека-хозяина [5]. Однако результаты, представленные здесь, показывают, что многие экологические виды, такие как A. baylyi , A. calcoaceticus и A. tjernbergiae, , а также клинически значимые виды A. nosocomialis и A. pittii проявляли Регуляция моторики синим светом также при 37°С.Такое дифференциальное поведение при 37°C по сравнению с A. baumannii может быть результатом дополнительного содержания предполагаемых фоторецепторов BLUF-домена, закодированных в геномах этих видов A. baumannii , отличных от (рис. 4 и табл. 2). Действительно, в геноме A. baumannii кодируется только один фоторецептор. Белок, присутствующий в штамме АТСС 17978, BlsA, скорее всего, функционирует только при 24°C: уровни мРНК blsA при 37°C значительно ниже по сравнению с уровнями при 24°C [5], а содержание белка BlsA в клетки при 37°C являются незначительными или нулевыми [Mussi et al., неопубликованные данные]. В качестве альтернативы, различное поведение при 37 ° C между A. baumannii и другими видами Acinetobacter может быть результатом идиосинкразических различий в паттернах экспрессии фоторецепторов и / или путей и партнеров, модулирующих подвижные функции ниже по течению от стадии фотосенсора у этих организмов. В любом случае A. baumannii мог стать «слепым» к свету при 37°C, потому что нет положительного отбора, реагирующего на этот стимул в относительной темноте теплокровных тканей хозяина.

Способность генов, содержащих BLUF-домен A. baylyi , восстанавливать фоторегуляцию при 24°C у мутанта ATCC 17978 blsA не только подтверждает, что они кодируют bona fide фоторецепторы BLUF, но также и то, что они могут преобразовывать свет сигнал в каскады регуляции подвижности и биопленки A. baumannii , вероятно, с использованием партнеров BlsA. В этом контексте A. baylyi образовывал большое количество биопленок при синем свете, а почти ничтожное количество — в условиях темноты.Примечательно поэтому, что при экспрессии фоторецепторов A.baulyi ´s у мутанта A.baumannii blsA наблюдается обратная ситуация, восстанавливающая во всех случаях соответствующий этому виду фенотип дикого типа. Следовательно, оба каскада у A. baumannii и A. baylyi , по-видимому, подвергаются обратному воздействию при 24°C, независимо от происхождения используемого фоторецептора.

Более того, мы обнаружили, что гены, содержащие BLUF-домен, показали себя как активные фоторецепторы в A.baumannii и A.baylyi , присутствуют во всех полностью секвенированных геномах, доступных для представителей этого рода, а также в штаммах, демонстрирующих фоторегуляцию подвижности и образование биопленок, таких как A. calcoaceticus ACI 412, A. nosocomialis ACI 32 и A. pittii ACI 988. Различное количество генов, кодирующих белки, содержащие домен BLUF (от одного до шести), у разных видов, проанализированных в этом исследовании, позволяет предположить, что восприятие света и реакция на свет могут иметь разное значение у разных видов. их, вероятно, отражая их различный образ жизни и разнообразие ниш, в которых они процветают.Филогенетический анализ предполагает общее происхождение для всех доменов BLUF в пределах Acinetobacter и позволяет различить хорошо дифференцированные кластеры, которые группируют вместе гомологи BLUF из разных видов, ситуация особенно ясна для членов комплекса ACB, которые, скорее всего, соответствуют группам ортологов. Различные кластеры могут отражать более тесную филогенетическую связь между видами с родственными ортологами, или наблюдаемая кластеризация могла быть результатом горизонтального переноса генов, кодирующих BLUF, среди видов Acinetobacter .

Наконец, мы не смогли обнаружить фоторегуляцию ни подвижности, ни образования биопленки у многих видов или штаммов рода Acinetobacter , несмотря на наличие нескольких генов, содержащих домен BLUF (например, 4–6 предполагаемых фоторецепторов домена BLUF). присутствует в геномах A. radioresistens , табл. 2). Это неудивительно, так как аналогичная ситуация была ранее нами описана в случае штамма A. baumannii ATCC 19606 T [5].Многие возможности могут привести к вышеуказанным результатам: механизмы подвижности или образования биопленок могут быть нарушены у некоторых из этих штаммов, или их специфические компоненты могут не экспрессироваться в изучаемых условиях. Тем не менее, свет может регулировать и другие клеточные процессы, не проверенные в этой работе. Кроме того, другие возможные объяснения предполагают, что гены фоторецепторов у этих штаммов могут не экспрессироваться в исследуемых условиях, соответствующие белки могут быть неактивны, или могут отсутствовать нижележащие партнеры сигнального каскада или мишени фоторецепторов, вовлеченных в эти фенотипы.Оставляя в стороне частные случаи, которые не были бы неожиданными, поскольку высокая генетическая гетерогенность была описана для штаммов некоторых представителей Acinetobacter , таких как A. baumannii [4], [5], [26], сохранение множественных Гены, содержащие BLUF-домен, а также тот факт, что они не подвергались генетическому происхождению, позволяют предположить, что они продолжают играть важную роль в физиологии бактерий. Скорее всего, эти предполагаемые фоторецепторы могут выполнять функции, модулирующие другие клеточные процессы, которые остаются неидентифицированными у этих видов.Тем не менее, функциональная характеристика белков, содержащих домен BLUF, кодируемых у видов рода Acinetobacter , отличных от белков A. baumannii или A. baylyi , все еще необходимо провести, чтобы установить их роль в качестве фоторецепторов, участвующих в восприятии света у животных. эти микроорганизмы. Что касается других клеточных процессов, на которые влияет свет, стоит отметить, что мы не смогли обнаружить световую регуляцию устойчивости к антибиотикам у различных клинически значимых видов рода Acinetobacter .Тем не менее, дальнейшие исследования помогут сделать окончательный вывод в этом смысле.

Наше понимание механизмов передачи сигнала и регуляторных каскадов, участвующих в A. baumannii BlsA и его гомологах, присутствующих в других видах рода Acinetobacter , все еще недостаточно и в настоящее время изучается в нашей лаборатории. Конечная цель состоит в том, чтобы получить полное представление о регуляции света в отношении ниш и образа жизни хозяина, что, возможно, потребует дальнейшего понимания биологии Acinetobacter .

Дополнительная информация

Рисунок S1.

Количественная оценка биопленок, продуцируемых различными штаммами, демонстрирующая фоторегуляцию образования биопленок в пределах рода Acinetobacter Планки погрешностей показывают стандартную ошибку среднего значения для 3 различных биологических повторов (n = 3). OD 580 / 600 , оптическая плотность при 580 или 600 нм соответственно.

https://doi.org/10.1371/journal.pone.0055059.s001

(ТИФ)

Таблица S1.

Синий свет и устойчивость к антибиотикам. Диско-диффузионный анализ на чувствительность к антибиотикам при синем свете или в темноте при 24 или 37°C некоторых штаммов A. nosocomialis , A. pittii и A. baumannii , которые показали фоторегуляцию подвижности и/или биопленку формирование. Штаммы A. haemolyticus , проанализированные в этой работе, не проявляли фоторегуляции ни подвижности, ни образования биопленок, но один штамм был включен в это исследование из-за важности этого вида в клинических условиях.Указан диаметр ингибирования из трех независимых экспериментов (мм +/- стандартная ошибка среднего для трех биологических повторностей). АМ, ампициллин; АН, амикацин; ФЭП, цефепим; СТХ, цефотаксим; ФОКС, цефокситин; CAZ, цефтазидим; CF, цефалотин; С, хлорамфеникол; CIP, ципрофлоксацин; ИПМ, имипенем; ГМ, гентамицин; МЕМ, меропенем; PIP, пиперацилин; РА, рифампицин.

https://doi.org/10.1371/journal.pone.0055059.s002

(XLSX)

Благодарности

Мы в долгу перед Р.J. Seviour за предоставление штаммов, представляющих некоторые из различных видов рода Acinetobacter . Мы также благодарим доктора Woojun Park за предоставление A. sp. DR1 (« A. oleivorans ») и доктору Харальду Сейферту за предоставление секвенированных геномов штаммов Acinetobacter . М.А.М. и А.М.В. являются профессиональными следователями CONICET.

Вклад авторов

Задумал и спроектировал эксперименты: MAM LAA. Выполняли опыты: А.Г. МАМ. Проанализированы данные: МАМ ЛАА М.В. АН.Предоставленные реагенты/материалы/инструменты для анализа: MAM AMV. Написал статью: MAM LAA AMV AN MV.

Каталожные номера

  1. 1. Vaneechoutte M, Kaempfer P, Dijkshoorn L, Nemec A, Wauters G (2011) Acinetobacter , Chryseobacterium , Moraxella и другие неферментирующие грамотрицательные палочки. В: Versalovic J, Carroll KA, Funke G, Jorgensen JH, Landry ML, Warnock DW, редакторы. Руководство по клинической микробиологии 10 th Ed. Вашингтон, округ Колумбия: ASM Press.714–738.
  2. 2. Немек А., Кризова Л., Майкснерова М., ван дер Рейден Т.Дж., Дешахт П. и соавт. (2011) Генотипическая и фенотипическая характеристика комплекса Acinetobacter calcoaceticus-Acinetobacter baumannii с предложением Acinetobacter pittii sp. ноябрь (ранее Acinetobacter геномный вид 3) и Acinetobacter nosocomialis sp. ноябрь (ранее Acinetobacter геномный вид 13TU). Res Microbiol 162: 393–404.
  3. 3. Догари Х., Ндакидеми П., Человек И., Бенаде С. (2011)Экология, биология и патогенез Acinetobacter spp.: обзор. Микробы Окружающая среда 26: 101–112.
  4. 4. Мусси М.А., Лиманский А.С., Реллинг В., Раваси П., Аракаки А. и соавт. (2011) Горизонтальный перенос генов/ассортативная рекомбинация в клинической популяции Acinetobacter baumannii обеспечивает генетическое разнообразие в одном гене carO , кодирующем основной белковый канал наружной мембраны.J Bacteriol 193: 4736–4748.
  5. 5. Мусси М.А., Гэдди Дж.А., Кабруджа М., Ариветт Б.А., Виале А.М. и др. (2010) Условно-патогенный микроорганизм человека Acinetobacter baumannii воспринимает свет и реагирует на него. J Bacteriol 192: 6336–6345.
  6. 6. Gaddy JA, Actis LA (2009) Регулирование образования биопленки Acinetobacter baumannii . Future Microbiol 4: 273–278.
  7. 7. Gaddy JA, Tomaras AP, Actis LA (2009) Белок Acinetobacter baumannii 19606 OmpA играет роль в формировании биопленки на абиотических поверхностях и взаимодействии этого патогена с эукариотическими клетками.Infect Immun 77: 3150–3160.
  8. 8. Томарас А.П., Дорси К.В., Эдельманн Р.Е., Актис Л.А. (2003)Прикрепление и образование биопленки на абиотических поверхностях с помощью Acinetobacter baumannii : участие новой системы сборки пилей шаперона-ашера. Микробиол 149: 3473–3484.
  9. 9. Dijkshoorn L, van Harsselaar B, Tjernberg I, Bouvet PJM, Vaneechoutte M (1998) Оценка рестрикционного анализа амплифицированной рибосомной ДНК для идентификации геномных видов Acinetobacter .System Appl Microbiol 21: 33–39.
  10. 10. Towner KJ, Bergogne-Berezin E, Fewson CA (1991) Acinetobacter : портрет рода. В KJ Towner, E. Bergogne-Berezin и CA Fewson, редакторы. Биология Acinetobacter . Нью-Йорк: Пленум Пресс. 1–24.
  11. 11. О’Тул Г.А., Пратт Л.А., Уотник П.И., Ньюман Д.К., Уивер В.Б. и др. (1999) Генетические подходы к изучению биопленок. Методы Enzymol 310: 91–109.
  12. 12. Sambrook J, Russell DW (2001) Молекулярное клонирование: лабораторное руководство, 3-е изд.Колд-Спринг-Харбор: Лабораторное издательство Колд-Спринг-Харбор.
  13. 13. Hunger M, Schmucker R, Kishan V, Hillen W (1990) Анализ и нуклеотидная последовательность источника репликации ДНК в Acinetobacter calcoaceticus и его использование для челночных плазмид Escherichia coli . Бытие 87: 45–51.
  14. 14. Стандарты производительности для тестов на чувствительность дисков к противомикробным препаратам: утвержденный стандарт M2-A9. (2006) Пенсильвания: Институт клинических и лабораторных стандартов.
  15. 15. Пунта М., Коггилл П.С., Эберхардт Р.Ю., Мистри Дж., Тейт Дж. и др. (2012) База данных семейств белков Pfam. База данных исследований нуклеиновых кислот, выпуск 40: D290–D301.
  16. 16. Томпсон Д.Д., Хиггинс Д.Г., Гибсон Т.Дж. (1994) CLUSTAL W: повышение чувствительности прогрессивного множественного выравнивания последовательностей за счет взвешивания последовательностей, штрафов за пробелы для конкретных позиций и выбора матрицы весов. Нуклеиновые кислоты Рез. 22: 4673–4680.
  17. 17. Гомельский М., Клуг Г. (2002) BLUF: новый FAD-связывающий домен, участвующий в сенсорной трансдукции у микроорганизмов.Trends Biochem Sci 27: 497–500.
  18. 18. Hall TA (1999) BioEdit: удобный редактор выравнивания биологических последовательностей и программа анализа для Windows 95/98/NT. Nucleic Acids Symp Ser 41: 95–98.
  19. 19. Felsenstein J (1989) Пакет логического вывода PHYLIP-филогенез (версия 3.2). Кластика 5: 164–166.
  20. 20. Diancourt L, Passet V, Nemec A, Dijkshoorn L, Brisse S (2010) Структура популяции Acinetobacter baumannii : расширение полирезистентных клонов из предкового восприимчивого генетического пула.ПЛОС ОДИН 5: e10034.
  21. 21. Nemec A, Vaneechoutte M, Dijkshoorn L (2009) Acinetobacter beijerinckii sp. ноябрь и Acinetobacter gyllenbergii sp. nov., гемолитические микроорганизмы, выделенные от человека. Int J Syst Evol Microbiol 59: 118–124.
  22. 22. Юнг А., Домрачева Т., Тарутина М., Ву К., Ко В. и др. (2005) Структура бактериального фоторецептора BLUF: понимание передачи сигнала, опосредованной синим светом. Proc Nat Acad Sci USA 102: 12350–12355.
  23. 23. Zan J, Cicirelli EM, Mohamed NM, Sibhatu H, Kroll S, et al. (2012)Сложная сеть восприятия кворума типа LuxR-LuxI у симбионта морской розеобактериальной губки активирует подвижность жгутика и ингибирует образование биопленки. Mol Microbiol В прессе.
  24. 24. Песавенто С., Беккер Г., Зоммерфельдт Н., Посслинг А., Човри Н. и др. (2008) Обратная регуляторная координация подвижности и курли-опосредованной адгезии у Escherichia coli . Гены Дев 22: 2434–2446.
  25. 25. Caiazza NC, Merritt JH, Brothers KM, O’Toole GA (2007) Обратная регуляция образования биопленки и подвижности роя с помощью Pseudomonas aeruginosa PA14. J Bacteriol 189: 3603–3612.
  26. 26. McQueary CN, Actis LA (2011) Acinetobacter baumannii биопленки: вариации среди штаммов и корреляции с другими свойствами клеток. J Microbiol 49: 243–250.
  27. 27. Bouvet PJM, Grimont P (1986) Таксономия рода Acinetobacter с признанием Acinetobacter baumannii sp.nov., Acinetobacter hemolyticus sp. nov., Acinetobacter johnsonii sp. nov. и Acinetobacter junii sp. ноябрь и измененные описания Acinetobacter calcoaceticus и Acinetobacter lwoffii . Int J Syst Bacteriol 36: 228–240.
  28. 28. Vaneechoutte M, Young DM, Ornston LN, De Baere T, Nemec A, et al. (2006) Естественная трансформация Acinetobacter sp. штамм ADP1 принадлежит к недавно описанному виду Acinetobacter baylyi .Appl Environ Microbiol 72: 932–936.
  29. 29. Немек А., Мусилек М., Седо О., Де Бэре Т., Майкснерова М. и др. (2010) Acinetobacter bereziniae sp. ноябрь и Acinetobacter guillouiae sp. nov., для размещения Acinetobacter геномных видов 10 и 11 соответственно. Int J Syst Evol Microbiol 60: 896–903.
  30. 30. Карр Э.Л., Кемпфер П., Патель Б.К., Гюртлер В., Севиур Р.Дж. (2003) Семь новых видов Acinetobacter , выделенных из активного ила.Int J Syst Evol Microbiol 53: 953–63.
  31. 31. Анандхам Р., Веон Х.И., Ким С.Дж., Ким Ю.С., Ким Б.И. и др. (2010) Acinetobacter brisouii sp. nov., выделенный из водно-болотного угодья в Корее. Дж. Микробиол. 48: 36–39.
  32. 32. Zhan Y, Yan Y, Zhang W, Yu H, Chen M, et al. (2011) Геномная последовательность Acinetobacter calcoaceticus PHEA-2, выделенная из промышленных сточных вод. J Бактериол 193: 2672-3.
  33. 33. Малхотра Дж., Ананд С., Джиндал С., Раман Р., Лал Р. (2012) Acinetobacter indicus sp.nov., выделенный из свалки гексахлорциклогексана (ГХГ). Int J Syst Evol Microbiol In Press.
  34. 34. Зайферт Х., Дейксхорн Л., Гернер-Смидт П., Пельцер Н., Тьернберг И. и др. (1997) Распределение видов Acinetobacter на коже человека: сравнение методов фенотипической и генотипической идентификации. J Clin Microbiol 35: 2819–2825.
  35. 35. Jung J, Baek JH, Park W (2010) Полная последовательность генома разлагающего дизельное топливо Acinetobacter sp.штамм DR1. J Bacteriol 192: 4794–4795.
  36. 36. Немек А., Дейксхорн Л., Клинверк И., Де Баре Т., Янссенс Д. и другие. (2003) Acinetobacter parvus sp. nov., небольшой колониеобразующий вид, выделенный из клинических образцов человека. Int J Syst Evol Microbiol 53: 1563–1567.
  37. 37. Nishimura Y, Kairiyama E, Shimadzu M, Iizuka H (1981) Характеристика радиационно-стойкого Acinetobacter . Z Allg Mikrobiol 21: 125–30.
  38. 38.Ваз-Морейра И., Ново А., Ханцис-Захаров Э., Лопес А.Р., Гомила М. и др. (2011) Acinetobacter rudis sp. nov., выделенный из сырого молока и сырых сточных вод. Int J Syst Evol Microbiol 61: 2837–2843.
  39. 39. Немек А., де Бэре Т., Тьернберг И., Ванихутте М., ван дер Рейден Т.Дж. и др. (2001) Acinetobacter ursingii sp. ноябрь и Acinetobacter schindleri sp. nov., выделенные из клинических образцов человека. Int J Syst Evol Microbiol 51: 1891–1899.
  40. 40. Vaneechoutte M, Nemec A, Musílek M, van der Reijden TJ, van den Barselaar M, et al. (2009) Описание Acinetobacter venetianus ex Di Cello et al. , 1997 г.р. nov.Int J Syst Evol Microbiol 59: 1376–1381.
  41. 41. Сослау Г., Рассел Дж. А., Спотила Дж. Р., Мэтью А. Дж., Багсияо П. и др. (2011) Acinetobacter sp. HM746599 выделен из крови кожистой черепахи. FEMS Microbiol Lett 322: 166–171.

Делирий в отделении интенсивной терапии: обзор | Анналы интенсивной терапии

  • Анонимное диагностическое и статистическое руководство по психическим расстройствам .4-е издание. Вашингтон, округ Колумбия: Американская психиатрическая ассоциация; 2000.

  • Liptzin B, Levkoff SE: Эмпирическое исследование подтипов делирия. Br J Psychiatry 1992, 161: 843–845. 10.1192/бджп.161.6.843

    КАС пабмед Google ученый

  • Engel GL, Romano J: Делирий, синдром церебральной недостаточности. 1959. J Neuropsychiatry Clin Neurosci 2004, 16 (4): 526–538.10.1176/appi.neuropsych.16.4.526

    PubMed Google ученый

  • Salluh JI, Soares M, Teles JM, Ceraso D, Raimondi N, Nava VS, Blasquez P, Ugarte S, Ibanez-Guzman C, Centeno JV, Laca M, Grecco G, Jimenez E, Arias-Rivera S, Duenas C, Rocha MG, Исследовательская группа по эпидемиологии делирия в интенсивной терапии: Эпидемиология делирия в интенсивной терапии (DECCA): международное исследование. Crit Care 2010, 14 (6):R210.10.1186/cc9333

    Центральный сайт PubMed пабмед Google ученый

  • Agarwal V, O’Neill PJ, Cotton BA, Pun BT, Haney S, Thompson J, Kassebaum N, Shintani A, Guy J, Ely EW, Pandharipande P: Распространенность и факторы риска развития делирия при ожогах пациентов отделения интенсивной терапии. J Burn Care Res 2010, 31 (5):706–715. 10.1097/BCR.0b013e3181eebee9

    Центр PubMed пабмед Google ученый

  • Roberts B, Rickard CM, Rajbhandari D, Turner G, Clarke J, Hill D, Tauschke C, Chaboyer W, Parsons R: Многоцентровое исследование делирия у пациентов отделения интенсивной терапии с использованием простого инструмента скрининга. Aust Crit Care 2005, 18 (1):6. 8–9, 11–14 проходов 10.1016/S1036-7314(05)80019-0

    PubMed Google ученый

  • Thomason JW, Shintani A, Peterson JF, Pun BT, Jackson JC, Ely EW: Делирий в отделении интенсивной терапии является независимым предиктором более длительного пребывания в больнице: проспективный анализ 261 невентилируемого пациента. Crit Care 2005, 9 (4):R375-R381. 10.1186/cc3729

    Центральный сайт PubMed пабмед Google ученый

  • Ely EW, Margolin R, Francis J, May L, Truman B, Dittus R, Speroff T, Gautam S, Bernard GR, Inouye SK: Оценка делирия у пациентов в критическом состоянии: валидация метода оценки спутанности сознания для отделение интенсивной терапии (CAM-ICU). Crit Care Med 2001, 29 (7):1370–1379. 10.1097/00003246-200107000-00012

    КАС пабмед Google ученый

  • Van Rompaey B, Schuurmans MJ, Shortridge-Baggett LM, Truijen S, Elseviers M, Bossaert L: Сравнение CAM-ICU и NEECHAM Confusion Scale в оценке делирия в интенсивной терапии: наблюдательное исследование в не- интубированные пациенты. Crit Care 2008, 12 (1):R16.10.1186/cc6790

    Центральный сайт PubMed пабмед Google ученый

  • Ely EW, Inouye SK, Bernard GR, Gordon S, Francis J, May L, Truman B, Speroff T, Gautam S, Margolin R, Hart RP, Dittus R: Делирий у пациентов с искусственной вентиляцией легких: достоверность и надежность метода оценки спутанности сознания для отделения интенсивной терапии (CAM-ICU). JAMA 2001, 286 (21):2703–2710. 10.1001/джама.286.21.2703

    КАС пабмед Google ученый

  • Peterson JF, Pun BT, Dittus RS, Thomason JW, Jackson JC, Shintani AK, Ely EW: Делирий и его моторные подтипы: исследование 614 пациентов в критическом состоянии. J Am Geriatr Soc 2006, 54 (3):479–484. 10.1111/j.1532-5415.2005.00621.x

    PubMed Google ученый

  • Robinson TN, Raeburn CD, Tran ZV, Brenner LA, Moss M: Моторные подтипы послеоперационного бреда у пожилых людей. Arch Surg 2011, 146 (3): 295–300. 10.1001/archsurg.2011.14

    PubMed Central пабмед Google ученый

  • Hshieh TT, Fong TG, Marcantonio ER, Inouye SK: Гипотеза холинергической недостаточности при делирии: синтез современных данных. J Gerontol A Biol Sci Med Sci 2008, 63 (7):764–772. 10.1093/gerona/63.7.764

    PubMed Central пабмед Google ученый

  • Han L, McCusker J, Cole M, Abrahamowicz M, Primeau F, Elie M: Использование препаратов с антихолинергическим эффектом предсказывает клиническую тяжесть симптомов делирия у пожилых стационарных пациентов. Arch Intern Med 2001, 161 (8):1099–1105.10.1001/архинте.161.8.1099

    CAS пабмед Google ученый

  • Flacker JM, Cummings V, Mach JR Jr, Bettin K, Kiely DK, Wei J: Связь антихолинергической активности сыворотки с делирием у пожилых пациентов. Am J Geriatr Psychiatry 1998, 6 (1):31–41.

    КАС пабмед Google ученый

  • Cerejeira J, Nogueira V, Luis P, Vaz-Serra A, Mukaetova-Ladinska EB: Холинергическая система и воспаление: общие пути в патофизиологии делирия. J Am Geriatr Soc 2012, 60 (4):669–675. 10.1111/j.1532-5415.2011.03883.x

    PubMed Google ученый

  • Girard TD, Ware LB, Bernard GR, Pandharipande PP, Thompson JL, Shintani AK, Jackson JC, Dittus RS, Ely EW: Связь маркеров воспаления и коагуляции с делирием во время критического состояния. Медицинская интенсивная терапия 2012, 38 (12):19651973.

    Google ученый

  • Chan CH, Liu HC, Huang MC: Делирий, связанный с одновременным применением низких доз бупропиона замедленного высвобождения и флуоксетина. J Clin Psychopharmacol 2006, 26 (6):677–679. 10.1097/01.jcp.0000246210.18777.c2

    PubMed Google ученый

  • ван Мюнстер Б.К., де Рой С.Э., Язданпанах М., Тиенари П.Дж., Питкала К.Х., Оссе Р.Дж., Адамис Д., Смит О., ван дер Стин М.С., ван Хаутен М., Рахконен Т., Сулкава Р., Лаурила Дж.В., Страндберг Т.Е. , Tulen JH, Zwang L, MacDonald AJ, Treloar A, Sijbrands EJ, Zwinderman AH, Korevaar JC: Ассоциация гена транспортера дофамина и гена рецептора допамина 2 с делирием, метаанализ. Am J Med Genet B Neuropsychiatr Genet 2010, 153B (2):648–655.

    КАС пабмед Google ученый

  • Flacker JM, Lipsitz LA: Нейронные механизмы бреда: современные гипотезы и развивающиеся концепции. J Gerontol A Biol Sci Med Sci 1999, 54 (6):B239-B246. 10.1093/герона/54.6.Б239

    КАС пабмед Google ученый

  • Choudhury M, Hote MP, Verma Y: Серотониновый синдром у послеоперационного пациента. J Anaesthesiol Clin Pharmacol 2011, 27 (2):233–235. 10.4103/0970-9185.81825

    Центральный пабмед пабмед Google ученый

  • Robinson TN, Raeburn CD, Angles EM, Moss M: Низкий уровень триптофана связан с послеоперационным делирием у пожилых людей. Am J Surg 2008, 196 (5): 670–674. 10.1016/j.amjsurg.2008.07.007

    CAS ПабМед Центральный пабмед Google ученый

  • Pandharipande PP, Morandi A, Adams JR, Girard TD, Thompson JL, Shintani AK, Ely EW: Уровни триптофана и тирозина в плазме являются независимыми факторами риска делирия у пациентов в критическом состоянии. Медицинская интенсивная терапия 2009, 35 (11):1886–1892. 10.1007/s00134-009-1573-6

    КАС ПабМед Центральный пабмед Google ученый

  • Adams Wilson JR, Morandi A, Girard TD, Thompson JL, Boomershine CS, Shintani AK, Ely EW, Pandharipande PP: Связь кинуренинового пути метаболизма триптофана с острой мозговой дисфункцией во время критических заболеваний*. Crit Care Med 2012, 40 (3):835–841.10.1097/ККМ.0б013е318236ф62д

    КАС ПабМед Центральный пабмед Google ученый

  • Maclullich AM, Ferguson KJ, Miller T, de Rooij SE, Cunningham C: Разгадка патофизиологии делирия: акцент на роли аберрантных реакций на стресс. J Psychosom Res 2008, 65 (3): 229–238. 10.1016/j.jpsychores.2008.05.019

    PubMed Central пабмед Google ученый

  • Davis KM, Wu JY: Роль глутаматергической и ГАМКергической систем при алкоголизме. J Biomed Sci 2001, 8 (1):7–19. 10.1007/БФ02255966

    КАС пабмед Google ученый

  • Kosten TR, O’Connor PG: Лечение отмены наркотиков и алкоголя. N Engl J Med 2003, 348 (18):1786–1795. 10.1056/NEJMra020617

    КАС пабмед Google ученый

  • Джайн Г., Чакрабарти С., Кулхара П.: Симптомы делирия: исследовательское факторное аналитическое исследование среди направленных пациентов. Gen Hosp Psychiatry 2011, 33 (4):377–385. 10.1016/j.genhosppsych.2011.05.001

    PubMed Google ученый

  • Дубин В.Р., Вайс К.Дж., Зеккарди Дж.А.: Органический мозговой синдром. Психиатрический самозванец. JAMA 1983, 249 (1): 60–62. 10.1001/джама.1983.03330250040025

    КАС пабмед Google ученый

  • Eidelman LA, Putterman D, Putterman C, Sprung CL: Спектр септической энцефалопатии.Определения, этиология и смертность. JAMA 1996, 275 (6): 470–473. 10.1001/джама.1996.03530300054040

    КАС пабмед Google ученый

  • Linnoila M, Mefford I, Nutt D, Adinoff B: Конференция NIH. Алкогольная абстиненция и норадренергическая функция. Ann Intern Med 1987, 107 (6):875–889.

    КАС пабмед Google ученый

  • Hall W, Zador D: Алкогольный абстинентный синдром. Ланцет 1997, 349 (9069): 1897–1900. 10.1016/С0140-6736(97)04572-8

    КАС пабмед Google ученый

  • van Eijk MM, van Marum RJ, Klijn IA, de Wit N, Kesecioglu J, Slooter AJ: Сравнение инструментов оценки делирия в смешанном отделении интенсивной терапии. Crit Care Med 2009, 37 (6):1881–1885. 10.1097/CCM.0b013e3181a00118

    PubMed Google ученый

  • Devlin JW, Fong JJ, Fraser GL, Riker RR: Оценка делирия у критически больных. Intensive Care Med 2007, 33 (6):929–940. 10.1007/s00134-007-0603-5

    PubMed Google ученый

  • Gaudreau JD, Gagnon P, Harel F, Tremblay A, Roy MA: Быстрая, систематическая и непрерывная оценка делирия у госпитализированных пациентов: шкала скрининга делирия у медсестер. J Управление симптомами боли 2005, 29 (4):368–375. 10.1016/j.jpainsymman.2004.07.009

    Google ученый

  • Hart RP, Best AM, Sessler CN, Levenson JL: Сокращенный когнитивный тест на делирий. J Psychosom Res 1997, 43 (4):417–423. 10.1016/S0022-3999(97)00140-2

    КАС пабмед Google ученый

  • Бержерон Н., Дюбуа М.Дж., Дюмон М., Дайал С., Скробик Ю.: Контрольный список для скрининга делирия в интенсивной терапии: оценка нового инструмента скрининга. Intensive Care Med 2001, 27 (5):859–864. 10.1007/s001340100909

    КАС пабмед Google ученый

  • Immers HE, Schuurmans MJ, van de Bijl JJ: Распознавание делирия у пациентов отделения интенсивной терапии: диагностическое исследование шкалы спутанности сознания NEECHAM у пациентов отделения интенсивной терапии. BMC Nurs 2005, 4: 7. 10.1186/1472-6955-4-7

    PubMed Central пабмед Google ученый

  • Оттер Х., Мартин Дж., Базелл К., фон Хейманн С., Хайн О.В., Боллерт П., Янш П., Бениш И., Вернеке К.Д., Конертц В., Лоенинг С., Бломер Ю.Ю., Спайс К.: Валидность и надежность DDS для оценки тяжести делирия в отделении интенсивной терапии. Neurocrit Care 2005, 2 (2):150–158. 10.1385/NCC:2:2:150

    PubMed Google ученый

  • Gaudreau JD, Gagnon P, Harel F, Tremblay A, Roy MA: Быстрая, систематическая и непрерывная оценка делирия у госпитализированных пациентов: шкала скрининга делирия у медсестер. J Управление симптомами боли 2005, 29 (4):368–375. 10.1016/j.jpainsymman.2004.07.009

    PubMed Google ученый

  • Wei LA, Fearing MA, Sternberg EJ, Inouye SK: Метод оценки путаницы: систематический обзор текущего использования. J Am Geriatr Soc 2008, 56 (5):823–830. 10.1111/j.1532-5415.2008.01674.x

    PubMed Central пабмед Google ученый

  • Pun BT, Gordon SM, Peterson JF, Shintani AK, Jackson JC, Foss J, Harding SD, Bernard GR, Dittus RS, Ely EW: Крупномасштабное внедрение седации и мониторинга делирия в отделении интенсивной терапии: отчет из двух медицинских центров. Crit Care Med 2005, 33 (6):1199–1205. 10.1097/01.CCM.0000166867.78320.AC

    PubMed Google ученый

  • Luetz A, Heymann A, Radtke FM, Chenitir C, Neuhaus U, Nachtigall I, von Dossow V, Marz S, Eggers V, Heinz A, Wernecke KD, Spies CD: Различные инструменты оценки бреда в отделении интенсивной терапии : какую оценку использовать? Crit Care Med 2010, 38 (2):409–418.10.1097/CCM.0b013e3181cabb42

    PubMed Google ученый

  • Торо А.С., Эскобар Л.М., Франко Х.Г., Диас-Гомес Х.Л., Муньос Х.Ф., Молина Ф., Бехарано Х., Йепес Д., Наварро Э., Гарсия А., Уэсли Эли Э., Эстебан А.: Испанская версия CAM- ICU (метод оценки спутанности сознания для отделения интенсивной терапии). Пилотное исследование валидации. Med Intensiva 2010, 34 (1):14–21. 10.1016/j.medin.2009.07.002

    CAS пабмед Google ученый

  • ван Эйк М.М., ван ден Бугаард М., ван Марум Р.Дж., Беннер П., Эйкеленбум П., Хонинг М.Л., ван дер Ховен Б., Хорн Дж., Изакс Г.Дж., Калф А., Каракус А., Клейн И.А., Койпер М.А., де Leeuw FE, de Man T, van der Mast RC, Osse RJ, de Rooij SE, Spronk PE, van der Voort PH, van Gool WA, Slooter AJ: Рутинное использование метода оценки спутанности сознания в отделении интенсивной терапии: мультицентр изучать. Am J Respir Crit Care Med 2011, 184 (3):340344.

    Google ученый

  • Vasilevskis EE, Morandi A, Boehm L, Pandharipande PP, Girard TD, Jackson JC, Thompson JL, Shintani A, Gordon SM, Pun BT, Wesley Ely E: Распознавание делирия и седативного эффекта с использованием проверенных инструментов: надежность у постели больного оценки медсестер отделения интенсивной терапии с 2007 по 2010 год. J Am Geriatr Soc 2011, 59 (Приложение 2): S249-S255.

    Центральный пабмед пабмед Google ученый

  • Нето А.С., Нассар А.П. младший, Кардосо С.О., Манетта Дж.А., Перейра В.Г., Эспозито Д.К., Дамаскено М.С., Слоотер А.Дж.: Скрининг делирия у пациентов в критическом состоянии: систематический обзор и метаанализ. Crit Care Med 2012, 40 (6):1946–1951. 10.1097/CCM.0b013e31824e16c9

    PubMed Google ученый

  • Gusmao-Flores D, Figueira Salluh JI, Chalhub RA, Quarantini LC: Метод оценки спутанности сознания для отделения интенсивной терапии (CAM-ICU) и контрольный список скрининга делирия для интенсивной терапии (ICDSC) для диагностики делирия: a систематический обзор и метаанализ клинических исследований. Crit Care 2012, 16 (4):R115. 10.1186/cc11407

    Центральный сайт PubMed пабмед Google ученый

  • Skrobik Y, Ahern S, Leblanc M, Marquis F, Awissi DK, Kavanagh BP: Протоколизированное управление обезболиванием, седацией и делирием в отделении интенсивной терапии улучшает обезболивание и частоту субсиндромального делирия. Anesth Analg 2010, 111 (2):451–463. 10.1213/ANE.0b013e3181d7e1b8

    PubMed Google ученый

  • Awissi DK, Begin C, Moisan J, Lachaine J, Skrobik Y: Исследование I-SAVE: влияние протоколов седации, анальгезии и делирия в отделении интенсивной терапии: экономическая оценка. Ann Pharmacother 2012, 46 (1):21–28. 10.1345/ап.1Q284

    PubMed Google ученый

  • Goncalves CA, Leite MC, Nardin P: Биологические и методологические особенности измерения S100B, предполагаемого маркера повреждения головного мозга. Clin Biochem 2008, 41 (10–11):755–763.

    КАС пабмед Google ученый

  • van Munster BC, Korse CM, de Rooij SE, Bonfrer JM, Zwinderman AH, Korevaar JC: Маркеры повреждения головного мозга во время бреда у пожилых пациентов с переломом бедра. BMC Neurol 2009, 9: 21. 10.1186/1471-2377-9-21

    PubMed Central пабмед Google ученый

  • McGrane S, Girard TD, Thompson JL, Shintani AK, Woodworth A, Ely EW, Pandharipande PP: Уровни прокальцитонина и С-реактивного белка при поступлении как предикторы продолжительности острой мозговой дисфункции у пациентов в критическом состоянии. Crit Care 2011, 15 (2):R78.10.1186/cc10070

    Центральный сайт PubMed пабмед Google ученый

  • van den Boogaard M, Kox M, Quinn KL, van Achterberg T, van der Hoeven JG, Schoonhoven L, Pickkers P: Биомаркеры, связанные с делирием у пациентов в критическом состоянии, и их связь с длительной субъективной когнитивной дисфункцией; показания для различных путей, управляющих делирием у воспаленных и невоспаленных пациентов. Crit Care 2011, 15 (6):R297.10.1186/cc10598

    Центр PubMed пабмед Google ученый

  • Grandi C, Tomasi CD, Fernandes K, Stertz L, Kapcchinski F, Quevedo J, Dal-Pizzol F, Ritter C: Нейротрофический фактор головного мозга и нейрон-специфическая енолаза, но не S100beta, связаны с возникновение делирия у пациентов отделения интенсивной терапии. J Crit Care 2011, 26 (2):133–137. 10.1016/j.jcrc.2010.10.006

    CAS пабмед Google ученый

  • van Munster BC, Bisschop PH, Zwinderman AH, Korevaar JC, Endert E, Wiersinga WJ, van Oosten HE, Goslings JC, de Rooij SE: Кортизол, интерлейкины и S100B при делирии у пожилых людей. Brain Cogn 2010, 74 (1):18–23. 10.1016/j.bandc.2010.05.010

    PubMed Google ученый

  • Lee HB, Mears SC, Rosenberg PB, Leoutsakos JM, Gottschalk A, Sieber FE: Факторы, предрасполагающие к послеоперационному делирию после восстановления перелома бедра у лиц с деменцией и без нее. J Am Geriatr Soc 2011, 59 (12):2306–2313. 10.1111/j.1532-5415.2011.03725.x

    PubMed Central пабмед Google ученый

  • Van Rompaey B, Schuurmans MJ, Shortridge-Baggett LM, Truijen S, Bossaert L: Факторы риска бреда в интенсивной терапии: систематический обзор. Медицинские сестры интенсивной терапии 2008, 24 (2):98–107. 10.1016/j.iccn.2007.08.005

    PubMed Google ученый

  • Alagiakrishnan K, Wiens CA: Подход к медикаментозному делирию у пожилых людей. Postgrad Med J 2004, 80 (945):388–393. 10.1136/pgmj.2003.017236

    CAS ПабМед Центральный пабмед Google ученый

  • Pandharipande P, Shintani A, Peterson J, Pun BT, Wilkinson GR, Dittus RS, Bernard GR, Ely EW: Лоразепам является независимым фактором риска развития делирия у пациентов отделений интенсивной терапии. Анестезиология 2006, 104 (1):21–26. 10.1097/00000542-200601000-00005

    КАС пабмед Google ученый

  • Ely EW, Shintani A, Truman B, Speroff T, Gordon SM, Harrell FE Jr, Inouye SK, Bernard GR, Dittus RS: Делирий как предиктор смертности у пациентов с искусственной вентиляцией легких в отделении интенсивной терапии. JAMA 2004, 291 (14): 1753–1762. 10.1001/Джама.291.14.1753

    КАС пабмед Google ученый

  • Shehabi Y, Riker RR, Bokesch PM, Wisemandle W, Shintani A, Ely EW, SEDCOM (Безопасность и эффективность дексмедетомидина по сравнению с мидазоламом) Исследовательская группа: Продолжительность делирия и смертность у пациентов интенсивной терапии с легкой седацией и механической вентиляцией легких . Crit Care Med 2010, 38 (12):2311–2318. 10.1097/CCM.0b013e3181f85759

    PubMed Google ученый

  • Писани М.А., Конг С.Ю., Касл С.В., Мерфи Т.Э., Араужо К.Л., Ван Несс Р.Г.: Дни делирия связаны со смертностью в течение 1 года среди пожилых пациентов отделения интенсивной терапии. Am J Respir Crit Care Med 2009, 180 (11):1092–1097. 10.1164/rccm.200904-0537OC

    PubMed Central пабмед Google ученый

  • Lat I, McMillian W, Taylor S, Janzen JM, Papadopoulos S, Korth L, Ehtisham A, Nold J, Agarwal S, Azocar R, Burke P: Влияние делирия на клинические результаты хирургических и травматологические больные. Crit Care Med 2009, 37 (6):1898–1905.10.1097/CCM.0b013e31819ffe38

    PubMed Google ученый

  • Marquis F, Ouimet S, Riker R, Cossette M, Skrobik Y: Индивидуальные симптомы делирия: имеют ли они значение? Crit Care Med 2007, 35 (11):2533–2537. 10.1097/01.CCM.0000284506.43390.F3

    PubMed Google ученый

  • Girard TD, Jackson JC, Pandharipande PP, Pun BT, Thompson JL, Shintani AK, Gordon SM, Canonico AE, Dittus RS, Bernard GR, Ely EW: Делирий как предиктор долгосрочных когнитивных нарушений у выживших критического заболевания. Crit Care Med 2010, 38 (7):1513–1520. 10.1097/CCM.0b013e3181e47be1

    Центральный PubMed пабмед Google ученый

  • van den Boogaard M, Schoonhoven L, Evers AW, van der Hoeven JG, van Achterberg T, Pickkers P: Делирий у пациентов в критическом состоянии: влияние на долгосрочное связанное со здоровьем качество жизни и когнитивные функции. Crit Care Med 2012, 40 (1):112–118.10.1097/CCM.0b013e31822e9fc9

    PubMed Google ученый

  • Inouye SK, Bogardus ST Jr, Charpentier PA, Leo-Summers L, Acampora D, Holford TR, Cooney LM Jr: Многокомпонентное вмешательство для предотвращения делирия у госпитализированных пожилых пациентов. N Engl J Med 1999, 340 (9):669–676. 10.1056/NEJM1993400901

    КАС пабмед Google ученый

  • Wenham T, Pittard A: Отделение интенсивной терапии. CEACCP 2009г., 9:

    Google ученый

  • Topf M, Bookman M, Arand D: Влияние шума в отделении интенсивной терапии на субъективное качество сна. J Adv Nurs 1996, 24 (3):545–551. 10.1046/j.1365-2648.1996.22315.x

    CAS пабмед Google ученый

  • Van Rompaey B, Elseviers MM, Van Drom W, Fromont V, Jorens PG: Влияние ночных затычек для ушей на возникновение бреда и восприятие сна: рандомизированное контролируемое исследование у пациентов интенсивной терапии. Crit Care 2012, 16 (3):R73. 10.1186/cc11330

    Центральный сайт PubMed пабмед Google ученый

  • Girard TD, Kress JP, Fuchs BD, Thomason JW, Schweickert WD, Pun BT, Taichman DB, Dunn JG, Pohlman AS, Kinniry PA, Jackson JC, Canonico AE, Light RW, Shintani AK, Thompson JL, Gordon С.М., Холл Дж.Б., Диттус Р.С., Бернард Г.Р., Эли Э.В.: . Эффективность и безопасность комбинированного протокола седации и отключения от аппарата ИВЛ у пациентов, находящихся на искусственной вентиляции легких в отделениях интенсивной терапии (исследование «Пробуждение и контролируемое дыхание»): рандомизированное контролируемое исследование. Ланцет 2008, 371 (9607):126–134. 10.1016/S0140-6736(08)60105-1

    PubMed Google ученый

  • Швейкерт В. Д., Полман М. С., Полман А. С., Нигос С., Павлик А. Дж., Эсбрук С. Л., Спирс Л., Миллер М., Франчик М., Деприцио Д., Шмидт Г. А., Боуман А., Барр Р., Маккаллистер К. Е., Холл Д. Б., Кресс JP: Ранняя физиотерапия и трудотерапия у пациентов в критическом состоянии, находящихся на искусственной вентиляции легких: рандомизированное контролируемое исследование. Ланцет 2009, 373 (9678): 1874–1882. 10.1016/S0140-6736(09)60658-9

    PubMed Google ученый

  • Якоби Дж., Фрейзер Г.Л., Курсин Д.Б., Рикер Р.Р., Фонтейн Д., Виттбродт Э.Т., Чалфин Д.Б., Масика М.Ф., Бьерке Х.С., Коплин В.М., Криппен Д.В., Фукс Б.Д., Келлехер Р.М., Марик П.Е., Насравей С.А. Murray MJ, Peruzzi WT, Lumb PD, Целевая группа Американского колледжа медицины критических состояний (ACCM) Общества медицины критических состояний (SCCM), Американского общества фармацевтов системы здравоохранения (ASHP), Американского колледжа врачей-пульмонологов: Клинические рекомендации по длительному применению седативных средств и анальгетиков у взрослых в критическом состоянии. Crit Care Med 2002, 30 (1):119–141. 10.1097/00003246-200201000-00020

    ПабМед Google ученый

  • Breitbart W, Marotta R, Platt MM, Weisman H, Derevenco M, Grau C, Corbera K, Raymond S, Lund S, Jacobson P: Двойное слепое исследование галоперидола, хлорпромазина и лоразепама в лечении Делирий у госпитализированных больных СПИДом. Am J Psychiatry 1996, 153 (2): 231–237.

    КАС пабмед Google ученый

  • Mayo-Smith MF: Фармакологическое лечение алкогольной абстиненции. Метаанализ и практическое руководство, основанное на фактических данных. Рабочая группа Американского общества наркологии по фармакологическому лечению алкогольной абстиненции. JAMA 1997, 278 (2): 144–151. 10.1001/джама.1997.03550020076042

    КАС пабмед Google ученый

  • Venn RM, Hell J, Grounds RM: Респираторные эффекты дексмедетомидина у хирургического пациента, нуждающегося в интенсивной терапии. Crit Care 2000, 4 (5):302–308. 10.1186/cc712

    КАС ПабМед Центральный пабмед Google ученый

  • Tan JA, Ho KM: Использование дексмедетомидина в качестве седативного и обезболивающего средства у взрослых пациентов в критическом состоянии: метаанализ. Intensive Care Med 2010, 36 (6):926–939. 10.1007/s00134-010-1877-6

    КАС пабмед Google ученый

  • Pandharipande PP, Pun BT, Herr DL, Maze M, Girard TD, Miller RR, Shintani AK, Thompson JL, Jackson JC, Deppen SA, Stiles RA, Dittus RS, Bernard GR, Ely EW: Эффект седации с дексмедетомидином по сравнению с лоразепамом при острой мозговой дисфункции у пациентов с искусственной вентиляцией легких: рандомизированное контролируемое исследование MENDS. JAMA 2007, 298 (22): 2644–2653. 10.1001/джама.298.22.2644

    КАС пабмед Google ученый

  • Jakob SM, Ruokonen E, Grounds RM, Sarapohja T, Garratt C, Pocock SJ, Bratty JR, Takala J, Дексмедетомидин для длительной седации Исследователи: Дексмедетомидин по сравнению с мидазоламом или пропофолом для седации при длительной механической вентиляции: два рандомизированные контролируемые испытания. JAMA 2012, 307 (11):1151–1160.10.1001/jama.2012.304

    CAS пабмед Google ученый

  • Bharati S, Pal A, Biswas C, Biswas R: Частота случаев остановки сердца увеличивается при неизбирательном применении дексмедетомидина: серия случаев и обзор опубликованных отчетов о случаях. Acta Anaesthesiol Taiwan 2011, 49 (4):165–167. 10.1016/j.aat.2011.11.010

    PubMed Google ученый

  • Gerlach AT, Murphy CV: Связанная с дексмедетомидином брадикардия, прогрессирующая до электрической активности без пульса: клинический случай и обзор литературы. Фармакотерапия 2009, 29 (12):1492. 10.1592/phco.29.12.1492

    PubMed Google ученый

  • Wang W, Li HL, Wang DX, Zhu X, Li SL, Yao GQ, Chen KS, Gu XE, Zhu SN: Профилактика галоперидолом снижает частоту делирия у пожилых пациентов после экстракардиальной хирургии: рандомизированное контролируемое исследование*. Crit Care Med 2012, 40 (3):731–739. 10.1097/CCM.0b013e3182376e4f

    PubMed Google ученый

  • Рид М.С., О’Салливан К., Бейтс С., Голдсмит Д., Эйнсли В.Р., Белломо Р.: Дексмедетомидин vs.галоперидол у пациентов с делирием, возбуждением и интубацией: рандомизированное открытое исследование. Crit Care 2009, 13 (3):R75. 10.1186/cc7890

    Центральный сайт PubMed пабмед Google ученый

  • Girard TD, Pandharipande PP, Carson SS, Schmidt GA, Wright PE, Canonico AE, Pun BT, Thompson JL, Shintani AK, Meltzer HY, Bernard GR, Dittus RS, Ely EW, MIND Trial Исследователи: Feasibility, Эффективность и безопасность нейролептиков при делирии в отделении интенсивной терапии: рандомизированное плацебо-контролируемое исследование MIND. Crit Care Med 2010, 38 (2):428–437. 10.1097/ККМ.0б013е3181к58715

    КАС ПабМед Центральный пабмед Google ученый

  • Devlin JW, Roberts RJ, Fong JJ, Skrobik Y, Riker RR, Hill NS, Robbins T, Garpestad E: Эффективность и безопасность кветиапина у пациентов в критическом состоянии с делирием: проспективное, многоцентровое, рандомизированное, двукратное исследование. слепое плацебо-контролируемое пилотное исследование. Crit Care Med 2010, 38 (2):419–427.10.1097/ККМ.0б013е3181б9е302

    КАС пабмед Google ученый

  • Скробик Ю.К., Бержерон Н., Дюмон М., Готфрид С.Б.: Оланзапин в сравнении с галоперидолом: лечение делирия в условиях интенсивной терапии. Intensive Care Med 2004, 30 (3):444–449. 10.1007/s00134-003-2117-0

    PubMed Google ученый

  • Reade MC: Крупнейшее в истории исследование, демонстрирующее эффективность профилактики делирия в отделениях интенсивной терапии — нам нужно знать больше! Crit Care Med 2012, 40 (8):2540.

    ПабМед Google ученый

  • Произошла ошибка при настройке пользовательского файла cookie

    Этот сайт использует файлы cookie для повышения производительности. Если ваш браузер не принимает файлы cookie, вы не можете просматривать этот сайт.


    Настройка браузера на прием файлов cookie

    Существует множество причин, по которым файл cookie не может быть установлен правильно. Ниже приведены наиболее распространенные причины:

    • В вашем браузере отключены файлы cookie.Вам необходимо сбросить настройки браузера, чтобы принять файлы cookie, или спросить вас, хотите ли вы принимать файлы cookie.
    • Ваш браузер спрашивает, хотите ли вы принимать файлы cookie, и вы отказались. Чтобы принять файлы cookie с этого сайта, нажмите кнопку «Назад» и примите файл cookie.
    • Ваш браузер не поддерживает файлы cookie. Попробуйте другой браузер, если вы подозреваете это.
    • Дата на вашем компьютере в прошлом. Если часы вашего компьютера показывают дату до 1 января 1970 г., браузер автоматически забудет файл cookie.Чтобы это исправить, установите правильное время и дату на своем компьютере.
    • Вы установили приложение, которое отслеживает или блокирует установку файлов cookie. Вы должны отключить приложение при входе в систему или проконсультироваться с системным администратором.

    Почему этому сайту требуются файлы cookie?

    Этот сайт использует файлы cookie для повышения производительности, запоминая, что вы вошли в систему, когда переходите со страницы на страницу. Предоставить доступ без файлов cookie потребует от сайта создания нового сеанса для каждой посещаемой вами страницы, что замедляет работу системы до неприемлемого уровня.


    Что сохраняется в файле cookie?

    Этот сайт не хранит ничего, кроме автоматически сгенерированного идентификатора сеанса в файле cookie; никакая другая информация не фиксируется.

    Как правило, в файле cookie может храниться только та информация, которую вы предоставляете, или выбор, который вы делаете при посещении веб-сайта. Например, сайт не может определить ваше имя электронной почты, если вы не решите ввести его. Разрешение веб-сайту создавать файлы cookie не дает этому или любому другому сайту доступ к остальной части вашего компьютера, и только сайт, создавший файл cookie, может его прочитать.

    «Богдан 2110» — народный автомобиль из Украины

    Корпорация «Богдан» производит обычные и коммерческие легковые, грузовые автомобили, автобусы и троллейбусы.

    Завод на базе 10-го семейства LADA собирает две обновленные версии автомобиля «Богдан 2110» — 21101 и 21104. Автомобиль представляет собой пятиместный седан с четырьмя дверьми.

    Базовая модель изменена: модернизированная светотехника, решетки радиатора и бампера, ветровое, заднее и задние боковые стекла крепятся на клей, для кузова используется оцинкованная сталь, а при ее использовании используется специальный катафорезный грунт, что повышает устойчивость к коррозии.

    Применение катафорезного грунта в 1996 году на АвтоВАЗе позволило увеличить стойкость металла в соляном тумане с 225 до 1500 часов, то есть почти в семь раз.

    На версии «Богдан 2110» обновлено оборудование – улучшена панель приборов, установлен бортовой компьютер, позволяющий контролировать расход топлива, температуру в салоне и на улице.

    Имеется 6 моделей «Богдан 2110» (седан). Это 21101-81; 21104-81, -84У, -84УЭ, -88У, -88УЭ.Все модели следующие. Двигатель объемом 1,596 л, мощностью 87,8 л.с. (двигатель потребляет 7,5 литров топлива по городу, чуть больше 6 литров по городу), шины 175/65R14, пятиступенчатая механическая коробка передач, бортовой компьютер, центральный замок. До 100 км/ч автомобиль умудряется разогнаться за 13 секунд. Передние двери оборудованы электростеклоподъемниками. Высота рулевой колонки регулируется, установлены иммобилайзер, задние противотуманные фонари с гидрокорректором. Подсветка приборной панели также регулируется.Сиденья водителя, пассажира и багажника, которые открываются из салона, подсвечиваются. Есть обогрев заднего стекла. Установлены пепельница, дополнительный стоп-сигнал, пять ремней безопасности, задний подлокотник и подголовники заднего дивана, аудиоподготовка. Бампера окрашены в цвет кузова.

    При комплектации в «стандартном» исполнении автомобиль «Богдан 2110» имеет следующие характеристики: регулируемая рулевая колонка, центральный замок, электрические стеклоподъемники, задние противотуманные фары, обогрев заднего стекла, аудиоподготовка, тонировка стекол в заводских условиях (анти -светоотражающее покрытие на заднем стекле), багажник открывается из салона.

    В моделях 21101-81 и -21104-82 бампер классический, в остальных — бампер завода Богдан.

    Модели 21104-88У и -88УЭ оснащены кондиционерами, а 21104-84УЭ и -88УЭ — электроподогревом сидений.

    Модели 21104 -84У, -84УЭ, -88У, -88УЭ снабжены электроусилителем руля, а литые диски есть не только у модели 21101-81.

    Для автомобилей «Богдан 2110» за доплату предлагаются передние противотуманные фары, световые диски, электроусилитель руля.

    Об автомобиле ВАЗ 2110 «Богдан» отзывы разные: как отрицательные, так и положительные.

    Основное мнение потребителя: автомобиль вполне соответствует цене, причем цена постепенно растет вместе с качеством сборки.

    Добавить комментарий

    Ваш адрес email не будет опубликован.